Incidental Mutation 'R7293:Copb1'
ID566553
Institutional Source Beutler Lab
Gene Symbol Copb1
Ensembl Gene ENSMUSG00000030754
Gene Namecoatomer protein complex, subunit beta 1
SynonymsCopb1, 2610019B04Rik
Accession Numbers

Genbank: NM_033370; MGI: 1917599

Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R7293 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location114215559-114254711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114219602 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 827 (M827K)
Ref Sequence ENSEMBL: ENSMUSP00000033012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033012]
Predicted Effect probably damaging
Transcript: ENSMUST00000033012
AA Change: M827K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033012
Gene: ENSMUSG00000030754
AA Change: M827K

DomainStartEndE-ValueType
Pfam:Adaptin_N 19 539 2.4e-124 PFAM
low complexity region 643 660 N/A INTRINSIC
Pfam:Coatamer_beta_C 667 807 3.6e-63 PFAM
Pfam:Coatomer_b_Cpla 813 944 3.1e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein subunit of the coatomer complex associated with non-clathrin coated vesicles. The coatomer complex, also known as the coat protein complex 1, forms in the cytoplasm and is recruited to the Golgi by activated guanosine triphosphatases. Once at the Golgi membrane, the coatomer complex may assist in the movement of protein and lipid components back to the endoplasmic reticulum. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A T 3: 92,868,819 C186S probably benign Het
Abcc2 G A 19: 43,807,053 G416E probably damaging Het
Acsl5 G T 19: 55,291,210 W460L probably damaging Het
Adam2 A G 14: 66,035,185 F614S probably benign Het
Adamts5 G A 16: 85,899,945 T108I probably benign Het
Agmat C T 4: 141,755,935 Q227* probably null Het
Alg11 A G 8: 22,065,379 N219D probably damaging Het
Amhr2 A G 15: 102,447,393 T258A probably benign Het
Ankrd53 A G 6: 83,763,196 E82G probably null Het
Blzf1 T A 1: 164,295,883 T292S possibly damaging Het
Capza1 T C 3: 104,840,835 D71G probably benign Het
Cc2d1b T C 4: 108,631,676 F770L probably benign Het
Cckbr A T 7: 105,434,645 Q260L probably benign Het
Cep162 T C 9: 87,203,783 T1163A probably benign Het
Chd9 T C 8: 91,034,079 S2151P unknown Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Cmya5 T A 13: 93,092,797 S1928C possibly damaging Het
Col24a1 C T 3: 145,486,304 Q1273* probably null Het
Col4a4 T C 1: 82,523,943 D363G unknown Het
Crocc C T 4: 141,043,556 A351T probably benign Het
Crybg1 T C 10: 44,003,432 T587A probably damaging Het
Csrnp3 A G 2: 65,949,000 R19G probably damaging Het
Cyb5rl T C 4: 107,080,946 I165T probably damaging Het
Dnah1 A T 14: 31,287,863 I1916N probably damaging Het
Dvl1 T C 4: 155,856,168 M415T possibly damaging Het
Dync2h1 A G 9: 7,001,454 S3845P possibly damaging Het
Eif3b A G 5: 140,419,428 Q23R probably benign Het
Esam G T 9: 37,537,724 R376L probably damaging Het
Fat3 G C 9: 15,915,040 H391D Het
Fat3 A C 9: 15,915,296 S305R Het
Fgd3 T C 13: 49,264,658 D644G probably benign Het
Fgf7 T C 2: 126,035,752 L13P probably damaging Het
Gas2l1 A G 11: 5,064,338 Y41H probably damaging Het
Glg1 A T 8: 111,168,743 I812N probably damaging Het
Glp1r C T 17: 30,924,625 H212Y probably benign Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gpr158 G A 2: 21,576,939 V410I possibly damaging Het
Ighv1-53 A T 12: 115,158,821 C5* probably null Het
Itgb2l A C 16: 96,426,796 Y502* probably null Het
Jakmip1 G A 5: 37,127,473 V635I probably benign Het
Krt23 C T 11: 99,483,856 M270I probably benign Het
Larp1b C T 3: 40,985,444 A344V Het
Lin28b T C 10: 45,419,186 M134V probably benign Het
Lrrc19 T A 4: 94,638,390 Y310F probably benign Het
Lyst T A 13: 13,680,237 D2397E probably benign Het
Map6 A G 7: 99,336,533 N751S possibly damaging Het
Mgrn1 G A 16: 4,932,220 D494N probably benign Het
Myh6 A G 14: 54,947,174 F1567L probably benign Het
Myo9b T C 8: 71,325,905 V461A probably benign Het
Ncan A T 8: 70,115,211 S84T probably damaging Het
Nlrp9a G A 7: 26,571,269 C908Y probably damaging Het
Olfr1264 A T 2: 90,021,527 Y180N probably damaging Het
Olfr1289 A G 2: 111,483,354 probably null Het
Olfr659 T A 7: 104,670,718 N5K probably damaging Het
Olfr949-ps1 A T 9: 39,364,834 M92L probably benign Het
Parp4 CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATATTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC 14: 56,647,846 probably benign Het
Pld1 C A 3: 28,087,286 T666K probably damaging Het
Pnpla6 A G 8: 3,538,068 Y1107C probably damaging Het
Pramel7 A C 2: 87,492,362 N19K probably benign Het
Prh1 C G 6: 132,571,758 P76R unknown Het
Prkd2 T C 7: 16,845,940 V121A possibly damaging Het
Ptprq G A 10: 107,635,506 Q1345* probably null Het
Ryr3 T A 2: 112,902,603 T653S probably benign Het
Sall2 G T 14: 52,314,411 Y442* probably null Het
Slc23a2 A C 2: 132,089,106 F158V probably benign Het
Smg1 C A 7: 118,166,099 R1954L unknown Het
Snx31 G A 15: 36,523,450 T362I probably damaging Het
Taf3 G T 2: 9,952,090 T422K probably damaging Het
Tcfl5 T C 2: 180,642,165 D142G probably benign Het
Tmx1 A G 12: 70,460,551 T188A probably damaging Het
Tnfrsf11a A G 1: 105,808,141 probably null Het
Trio A T 15: 27,871,289 C640S possibly damaging Het
Ulk4 T G 9: 121,255,124 N427T probably damaging Het
Vmn1r202 T C 13: 22,501,702 M182V probably benign Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Other mutations in Copb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Copb1 APN 7 114226776 missense probably benign 0.00
IGL02458:Copb1 APN 7 114246785 missense probably benign 0.00
IGL02549:Copb1 APN 7 114246797 missense probably benign 0.00
IGL02639:Copb1 APN 7 114226595 splice site probably benign
robbers UTSW 7 114248976 missense probably damaging 1.00
R0012:Copb1 UTSW 7 114237408 missense probably damaging 0.99
R0012:Copb1 UTSW 7 114237408 missense probably damaging 0.99
R0023:Copb1 UTSW 7 114250094 missense probably benign 0.26
R0631:Copb1 UTSW 7 114233282 missense probably benign 0.12
R1996:Copb1 UTSW 7 114232203 missense probably benign 0.00
R2256:Copb1 UTSW 7 114253875 missense possibly damaging 0.89
R2257:Copb1 UTSW 7 114253875 missense possibly damaging 0.89
R3853:Copb1 UTSW 7 114223316 missense probably damaging 1.00
R4679:Copb1 UTSW 7 114248976 missense probably damaging 1.00
R4686:Copb1 UTSW 7 114221736 missense possibly damaging 0.94
R5057:Copb1 UTSW 7 114226762 missense probably benign
R5140:Copb1 UTSW 7 114246800 missense probably benign 0.01
R5669:Copb1 UTSW 7 114237585 missense probably damaging 1.00
R5779:Copb1 UTSW 7 114219572 missense probably damaging 1.00
R6017:Copb1 UTSW 7 114236797 missense probably benign 0.07
R6114:Copb1 UTSW 7 114246801 missense probably benign 0.00
R6403:Copb1 UTSW 7 114238451 missense probably damaging 1.00
R6826:Copb1 UTSW 7 114226719 missense probably benign 0.00
R6905:Copb1 UTSW 7 114253890 missense probably benign 0.00
R7241:Copb1 UTSW 7 114237356 missense probably damaging 0.96
R7485:Copb1 UTSW 7 114245485 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACTTTATATGCCCCAGTACAGG -3'
(R):5'- CAATTGATGGCACTATTCAGTTGG -3'

Sequencing Primer
(F):5'- ACTTTTGGGATAGCATTGGAAATG -3'
(R):5'- CACCCTTTGGGGATCTTT -3'
Posted On2019-06-26