Incidental Mutation 'R7297:Pkib'
ID566747
Institutional Source Beutler Lab
Gene Symbol Pkib
Ensembl Gene ENSMUSG00000019876
Gene Nameprotein kinase inhibitor beta, cAMP dependent, testis specific
SynonymsPKIbeta, Prkacn2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7297 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location57631981-57741112 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57736326 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 101 (Q101L)
Ref Sequence ENSEMBL: ENSMUSP00000093329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066028] [ENSMUST00000075992] [ENSMUST00000095668] [ENSMUST00000175852] [ENSMUST00000177325] [ENSMUST00000177473]
Predicted Effect probably damaging
Transcript: ENSMUST00000066028
AA Change: Q69L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067532
Gene: ENSMUSG00000019876
AA Change: Q69L

DomainStartEndE-ValueType
Pfam:PKI 9 78 3.3e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075992
AA Change: Q69L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075374
Gene: ENSMUSG00000019876
AA Change: Q69L

DomainStartEndE-ValueType
Pfam:PKI 9 78 3.3e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000095668
AA Change: Q101L

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093329
Gene: ENSMUSG00000019876
AA Change: Q101L

DomainStartEndE-ValueType
Pfam:PKI 41 109 1.8e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175852
AA Change: Q69L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135666
Gene: ENSMUSG00000019876
AA Change: Q69L

DomainStartEndE-ValueType
Pfam:PKI 9 78 3.3e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177325
AA Change: Q69L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135280
Gene: ENSMUSG00000019876
AA Change: Q69L

DomainStartEndE-ValueType
Pfam:PKI 9 78 3.3e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177473
AA Change: Q69L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135835
Gene: ENSMUSG00000019876
AA Change: Q69L

DomainStartEndE-ValueType
Pfam:PKI 9 78 3.3e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cAMP-dependent protein kinase inhibitor family. The encoded protein may play a role in the protein kinase A (PKA) pathway by interacting with the catalytic subunit of PKA, and overexpression of this gene may play a role in prostate cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced protein kinase inhibitor activity in the testis but are phenotypically normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Abca6 C T 11: 110,183,026 probably null Het
Adh4 A G 3: 138,429,140 I358M possibly damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Arap3 G A 18: 37,973,563 A1409V possibly damaging Het
Arhgap22 C T 14: 33,271,933 R68* probably null Het
Arhgef4 A T 1: 34,807,192 D207V probably damaging Het
Asb15 A G 6: 24,566,463 T472A probably damaging Het
Ascl1 A T 10: 87,492,464 S209T probably damaging Het
Asxl1 T C 2: 153,397,435 V382A probably benign Het
Atp11a T C 8: 12,806,774 probably null Het
Calu C T 6: 29,356,555 R27* probably null Het
Cdh20 A G 1: 104,970,873 T442A probably benign Het
Chrm3 T A 13: 9,877,833 Q389L probably benign Het
Cntnap1 A G 11: 101,188,634 T1233A probably benign Het
Cwc15 G A 9: 14,510,229 C197Y probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dennd3 C T 15: 73,557,610 T914I probably damaging Het
Dlx3 C A 11: 95,120,450 Y43* probably null Het
Dnah17 A T 11: 118,055,730 probably null Het
Dnah17 A G 11: 118,103,356 F1081S probably damaging Het
Dpp10 G A 1: 123,353,428 Q631* probably null Het
Dsel T A 1: 111,861,776 D343V probably damaging Het
Efcab12 T C 6: 115,811,036 D655G possibly damaging Het
Epha8 T A 4: 136,945,913 I187L probably damaging Het
Exosc10 A G 4: 148,580,377 K781E probably damaging Het
Exosc5 T C 7: 25,666,326 L200P probably benign Het
Faiml T C 9: 99,229,613 E131G probably damaging Het
Gm13723 A T 2: 86,873,636 V29E probably damaging Het
Gm5145 G A 17: 20,570,731 V124I probably benign Het
Grm7 T C 6: 110,646,013 V49A probably benign Het
Gtf2e1 T C 16: 37,536,065 D35G probably damaging Het
Heatr1 C T 13: 12,421,060 Q1160* probably null Het
Herc2 T A 7: 56,136,658 C1584S probably benign Het
Hsd17b3 T C 13: 64,076,351 I88V probably damaging Het
Hspa14 A C 2: 3,498,142 L205R possibly damaging Het
Ifna11 A C 4: 88,820,425 E156A possibly damaging Het
Krt83 T C 15: 101,489,647 D170G probably benign Het
Mas1 T C 17: 12,841,858 Y226C probably damaging Het
Micall1 T C 15: 79,120,897 F190L unknown Het
Msi2 A T 11: 88,480,038 L141Q probably damaging Het
Nfkbib T C 7: 28,766,343 D27G probably benign Het
Nlrp9b A G 7: 20,049,513 D927G possibly damaging Het
Nrg3 T C 14: 38,370,939 D579G probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr26 G A 9: 38,855,949 D296N probably damaging Het
Parp4 C T 14: 56,647,681 P1406S not run Het
Plat C T 8: 22,775,697 T252I probably benign Het
Ppm1d A T 11: 85,345,995 E533D probably damaging Het
Psd3 T C 8: 68,121,034 K165R probably damaging Het
Psg29 T A 7: 17,210,691 Y375* probably null Het
Pus7 A T 5: 23,741,910 I644N probably damaging Het
Rbbp9 A T 2: 144,543,802 M181K probably benign Het
Rell1 A T 5: 63,936,075 N112K possibly damaging Het
Simc1 AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG 13: 54,525,235 probably benign Het
Skint5 G A 4: 113,542,934 T1184M unknown Het
Slc27a2 T A 2: 126,578,946 D452E probably damaging Het
Slc44a4 T A 17: 34,927,912 I489N probably damaging Het
Slfn14 T A 11: 83,278,995 K608* probably null Het
Snx15 T A 19: 6,120,507 I301F probably damaging Het
Sost C T 11: 101,964,103 G127R probably damaging Het
Stt3b A G 9: 115,276,957 I150T probably damaging Het
Susd2 T C 10: 75,642,568 D58G probably benign Het
Tex46 T G 4: 136,612,901 V99G probably damaging Het
Tgfbi T A 13: 56,632,113 F492I possibly damaging Het
Tmem132c G A 5: 127,360,217 A257T probably benign Het
Trim2 A T 3: 84,210,233 I51K probably damaging Het
Tsn A T 1: 118,300,861 Y210* probably null Het
Umodl1 G A 17: 31,008,665 R1324H probably benign Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r5 A T 6: 56,986,219 N293I possibly damaging Het
Vmn2r124 A T 17: 18,073,573 I641F probably damaging Het
Vmn2r84 T C 10: 130,391,250 N240D probably benign Het
Wbp1l A G 19: 46,654,400 D264G possibly damaging Het
Other mutations in Pkib
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2508:Pkib UTSW 10 57728109 missense probably damaging 1.00
R4760:Pkib UTSW 10 57708150 missense probably benign 0.04
R6416:Pkib UTSW 10 57728138 missense probably damaging 0.99
R7526:Pkib UTSW 10 57736298 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGACTCAAATATTTCCTCTCTATGCAG -3'
(R):5'- GCTGCAGTTTAAGGACAGAGC -3'

Sequencing Primer
(F):5'- CTGCATGAGTAGGCAAAG -3'
(R):5'- CTGCAGTTTAAGGACAGAGCATCAC -3'
Posted On2019-06-26