Incidental Mutation 'R7297:Snx15'
ID566779
Institutional Source Beutler Lab
Gene Symbol Snx15
Ensembl Gene ENSMUSG00000024787
Gene Namesorting nexin 15
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7297 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location6119399-6128304 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6120507 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 301 (I301F)
Ref Sequence ENSEMBL: ENSMUSP00000025702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025702] [ENSMUST00000044451] [ENSMUST00000113533] [ENSMUST00000138931] [ENSMUST00000154601]
Predicted Effect probably damaging
Transcript: ENSMUST00000025702
AA Change: I301F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025702
Gene: ENSMUSG00000024787
AA Change: I301F

DomainStartEndE-ValueType
PX 8 126 1.78e-22 SMART
low complexity region 140 151 N/A INTRINSIC
MIT 265 337 7.77e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044451
SMART Domains Protein: ENSMUSP00000044231
Gene: ENSMUSG00000054999

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
Pfam:PA 163 256 3e-12 PFAM
Pfam:Peptidase_M28 353 564 1.3e-22 PFAM
low complexity region 579 592 N/A INTRINSIC
Pfam:TFR_dimer 621 740 4.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113533
SMART Domains Protein: ENSMUSP00000109161
Gene: ENSMUSG00000024790

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
Pfam:SAC3_GANP 134 356 7.6e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138931
SMART Domains Protein: ENSMUSP00000114189
Gene: ENSMUSG00000024787

DomainStartEndE-ValueType
PX 8 112 1.69e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154601
SMART Domains Protein: ENSMUSP00000122740
Gene: ENSMUSG00000024787

DomainStartEndE-ValueType
PX 8 126 1.78e-22 SMART
low complexity region 140 151 N/A INTRINSIC
Blast:MIT 222 251 4e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. Overexpression of this gene results in a decrease in the processing of insulin and hepatocyte growth factor receptors to their mature subunits. This decrease is caused by the mislocalization of furin, the endoprotease responsible for cleavage of insulin and hepatocyte growth factor receptors. This protein is involved in endosomal trafficking from the plasma membrane to recycling endosomes or the trans-Golgi network. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream ADP-ribosylation factor-like 2 (ARL2) gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Abca6 C T 11: 110,183,026 probably null Het
Adh4 A G 3: 138,429,140 I358M possibly damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Arap3 G A 18: 37,973,563 A1409V possibly damaging Het
Arhgap22 C T 14: 33,271,933 R68* probably null Het
Arhgef4 A T 1: 34,807,192 D207V probably damaging Het
Asb15 A G 6: 24,566,463 T472A probably damaging Het
Ascl1 A T 10: 87,492,464 S209T probably damaging Het
Asxl1 T C 2: 153,397,435 V382A probably benign Het
Atp11a T C 8: 12,806,774 probably null Het
Calu C T 6: 29,356,555 R27* probably null Het
Cdh20 A G 1: 104,970,873 T442A probably benign Het
Chrm3 T A 13: 9,877,833 Q389L probably benign Het
Cntnap1 A G 11: 101,188,634 T1233A probably benign Het
Cwc15 G A 9: 14,510,229 C197Y probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dennd3 C T 15: 73,557,610 T914I probably damaging Het
Dlx3 C A 11: 95,120,450 Y43* probably null Het
Dnah17 A T 11: 118,055,730 probably null Het
Dnah17 A G 11: 118,103,356 F1081S probably damaging Het
Dpp10 G A 1: 123,353,428 Q631* probably null Het
Dsel T A 1: 111,861,776 D343V probably damaging Het
Efcab12 T C 6: 115,811,036 D655G possibly damaging Het
Epha8 T A 4: 136,945,913 I187L probably damaging Het
Exosc10 A G 4: 148,580,377 K781E probably damaging Het
Exosc5 T C 7: 25,666,326 L200P probably benign Het
Faiml T C 9: 99,229,613 E131G probably damaging Het
Gm13723 A T 2: 86,873,636 V29E probably damaging Het
Gm5145 G A 17: 20,570,731 V124I probably benign Het
Grm7 T C 6: 110,646,013 V49A probably benign Het
Gtf2e1 T C 16: 37,536,065 D35G probably damaging Het
Heatr1 C T 13: 12,421,060 Q1160* probably null Het
Herc2 T A 7: 56,136,658 C1584S probably benign Het
Hsd17b3 T C 13: 64,076,351 I88V probably damaging Het
Hspa14 A C 2: 3,498,142 L205R possibly damaging Het
Ifna11 A C 4: 88,820,425 E156A possibly damaging Het
Krt83 T C 15: 101,489,647 D170G probably benign Het
Mas1 T C 17: 12,841,858 Y226C probably damaging Het
Micall1 T C 15: 79,120,897 F190L unknown Het
Msi2 A T 11: 88,480,038 L141Q probably damaging Het
Nfkbib T C 7: 28,766,343 D27G probably benign Het
Nlrp9b A G 7: 20,049,513 D927G possibly damaging Het
Nrg3 T C 14: 38,370,939 D579G probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr26 G A 9: 38,855,949 D296N probably damaging Het
Parp4 C T 14: 56,647,681 P1406S not run Het
Pkib A T 10: 57,736,326 Q101L possibly damaging Het
Plat C T 8: 22,775,697 T252I probably benign Het
Ppm1d A T 11: 85,345,995 E533D probably damaging Het
Psd3 T C 8: 68,121,034 K165R probably damaging Het
Psg29 T A 7: 17,210,691 Y375* probably null Het
Pus7 A T 5: 23,741,910 I644N probably damaging Het
Rbbp9 A T 2: 144,543,802 M181K probably benign Het
Rell1 A T 5: 63,936,075 N112K possibly damaging Het
Simc1 AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG 13: 54,525,235 probably benign Het
Skint5 G A 4: 113,542,934 T1184M unknown Het
Slc27a2 T A 2: 126,578,946 D452E probably damaging Het
Slc44a4 T A 17: 34,927,912 I489N probably damaging Het
Slfn14 T A 11: 83,278,995 K608* probably null Het
Sost C T 11: 101,964,103 G127R probably damaging Het
Stt3b A G 9: 115,276,957 I150T probably damaging Het
Susd2 T C 10: 75,642,568 D58G probably benign Het
Tex46 T G 4: 136,612,901 V99G probably damaging Het
Tgfbi T A 13: 56,632,113 F492I possibly damaging Het
Tmem132c G A 5: 127,360,217 A257T probably benign Het
Trim2 A T 3: 84,210,233 I51K probably damaging Het
Tsn A T 1: 118,300,861 Y210* probably null Het
Umodl1 G A 17: 31,008,665 R1324H probably benign Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r5 A T 6: 56,986,219 N293I possibly damaging Het
Vmn2r124 A T 17: 18,073,573 I641F probably damaging Het
Vmn2r84 T C 10: 130,391,250 N240D probably benign Het
Wbp1l A G 19: 46,654,400 D264G possibly damaging Het
Other mutations in Snx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Snx15 APN 19 6119885 missense probably benign 0.00
IGL02102:Snx15 APN 19 6122074 missense possibly damaging 0.69
PIT4418001:Snx15 UTSW 19 6123931 missense probably damaging 1.00
R0079:Snx15 UTSW 19 6123913 missense probably damaging 1.00
R0654:Snx15 UTSW 19 6121885 missense probably benign 0.33
R1499:Snx15 UTSW 19 6122064 missense probably damaging 1.00
R1943:Snx15 UTSW 19 6128066 missense probably damaging 1.00
R2991:Snx15 UTSW 19 6121485 missense probably damaging 0.99
R3769:Snx15 UTSW 19 6123954 splice site probably benign
R5117:Snx15 UTSW 19 6124151 critical splice donor site probably null
R5763:Snx15 UTSW 19 6122110 missense probably damaging 0.99
R6219:Snx15 UTSW 19 6121508 missense probably damaging 0.99
R7024:Snx15 UTSW 19 6120596 missense probably damaging 0.98
Z1088:Snx15 UTSW 19 6121411 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAACAGATGTTCACGGTCCCTC -3'
(R):5'- CAGCCATTGAGGTAGAGTCC -3'

Sequencing Primer
(F):5'- TATGCCAGGTTCAGCTGC -3'
(R):5'- CCATTGAGGTAGAGTCCAAAAGGC -3'
Posted On2019-06-26