Incidental Mutation 'R7297:Tgfbi'
ID566764
Institutional Source Beutler Lab
Gene Symbol Tgfbi
Ensembl Gene ENSMUSG00000035493
Gene Nametransforming growth factor, beta induced
Synonyms68kDa, bIG-h3, Beta-ig
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R7297 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location56609523-56639562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56632113 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 492 (F492I)
Ref Sequence ENSEMBL: ENSMUSP00000037719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045173] [ENSMUST00000225600]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045173
AA Change: F492I

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037719
Gene: ENSMUSG00000035493
AA Change: F492I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 139 239 1.35e-33 SMART
FAS1 276 374 6.75e-34 SMART
FAS1 411 501 1.16e-14 SMART
FAS1 538 635 6.75e-34 SMART
low complexity region 656 667 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000225600
AA Change: F492I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. This protein plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. The protein is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in this gene are associated with multiple types of corneal dystrophy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show delayed growth and are prone to spontaneous and induced tumors. Homozygotes for a second null allele are prone to STZ-induced diabetes and show impaired islet function under stress. Homozygotes for a third null allele show a transient decrease in retinal apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Abca6 C T 11: 110,183,026 probably null Het
Adh4 A G 3: 138,429,140 I358M possibly damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Arap3 G A 18: 37,973,563 A1409V possibly damaging Het
Arhgap22 C T 14: 33,271,933 R68* probably null Het
Arhgef4 A T 1: 34,807,192 D207V probably damaging Het
Asb15 A G 6: 24,566,463 T472A probably damaging Het
Ascl1 A T 10: 87,492,464 S209T probably damaging Het
Asxl1 T C 2: 153,397,435 V382A probably benign Het
Atp11a T C 8: 12,806,774 probably null Het
Calu C T 6: 29,356,555 R27* probably null Het
Cdh20 A G 1: 104,970,873 T442A probably benign Het
Chrm3 T A 13: 9,877,833 Q389L probably benign Het
Cntnap1 A G 11: 101,188,634 T1233A probably benign Het
Cwc15 G A 9: 14,510,229 C197Y probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dennd3 C T 15: 73,557,610 T914I probably damaging Het
Dlx3 C A 11: 95,120,450 Y43* probably null Het
Dnah17 A T 11: 118,055,730 probably null Het
Dnah17 A G 11: 118,103,356 F1081S probably damaging Het
Dpp10 G A 1: 123,353,428 Q631* probably null Het
Dsel T A 1: 111,861,776 D343V probably damaging Het
Efcab12 T C 6: 115,811,036 D655G possibly damaging Het
Epha8 T A 4: 136,945,913 I187L probably damaging Het
Exosc10 A G 4: 148,580,377 K781E probably damaging Het
Exosc5 T C 7: 25,666,326 L200P probably benign Het
Faiml T C 9: 99,229,613 E131G probably damaging Het
Gm13723 A T 2: 86,873,636 V29E probably damaging Het
Gm5145 G A 17: 20,570,731 V124I probably benign Het
Grm7 T C 6: 110,646,013 V49A probably benign Het
Gtf2e1 T C 16: 37,536,065 D35G probably damaging Het
Heatr1 C T 13: 12,421,060 Q1160* probably null Het
Herc2 T A 7: 56,136,658 C1584S probably benign Het
Hsd17b3 T C 13: 64,076,351 I88V probably damaging Het
Hspa14 A C 2: 3,498,142 L205R possibly damaging Het
Ifna11 A C 4: 88,820,425 E156A possibly damaging Het
Krt83 T C 15: 101,489,647 D170G probably benign Het
Mas1 T C 17: 12,841,858 Y226C probably damaging Het
Micall1 T C 15: 79,120,897 F190L unknown Het
Msi2 A T 11: 88,480,038 L141Q probably damaging Het
Nfkbib T C 7: 28,766,343 D27G probably benign Het
Nlrp9b A G 7: 20,049,513 D927G possibly damaging Het
Nrg3 T C 14: 38,370,939 D579G probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr26 G A 9: 38,855,949 D296N probably damaging Het
Parp4 C T 14: 56,647,681 P1406S not run Het
Pkib A T 10: 57,736,326 Q101L possibly damaging Het
Plat C T 8: 22,775,697 T252I probably benign Het
Ppm1d A T 11: 85,345,995 E533D probably damaging Het
Psd3 T C 8: 68,121,034 K165R probably damaging Het
Psg29 T A 7: 17,210,691 Y375* probably null Het
Pus7 A T 5: 23,741,910 I644N probably damaging Het
Rbbp9 A T 2: 144,543,802 M181K probably benign Het
Rell1 A T 5: 63,936,075 N112K possibly damaging Het
Simc1 AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG 13: 54,525,235 probably benign Het
Skint5 G A 4: 113,542,934 T1184M unknown Het
Slc27a2 T A 2: 126,578,946 D452E probably damaging Het
Slc44a4 T A 17: 34,927,912 I489N probably damaging Het
Slfn14 T A 11: 83,278,995 K608* probably null Het
Snx15 T A 19: 6,120,507 I301F probably damaging Het
Sost C T 11: 101,964,103 G127R probably damaging Het
Stt3b A G 9: 115,276,957 I150T probably damaging Het
Susd2 T C 10: 75,642,568 D58G probably benign Het
Tex46 T G 4: 136,612,901 V99G probably damaging Het
Tmem132c G A 5: 127,360,217 A257T probably benign Het
Trim2 A T 3: 84,210,233 I51K probably damaging Het
Tsn A T 1: 118,300,861 Y210* probably null Het
Umodl1 G A 17: 31,008,665 R1324H probably benign Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r5 A T 6: 56,986,219 N293I possibly damaging Het
Vmn2r124 A T 17: 18,073,573 I641F probably damaging Het
Vmn2r84 T C 10: 130,391,250 N240D probably benign Het
Wbp1l A G 19: 46,654,400 D264G possibly damaging Het
Other mutations in Tgfbi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Tgfbi APN 13 56630595 missense probably benign 0.41
IGL02021:Tgfbi APN 13 56631353 missense probably damaging 1.00
IGL02325:Tgfbi APN 13 56631230 missense probably benign 0.00
PIT4486001:Tgfbi UTSW 13 56629794 missense probably damaging 0.98
R0008:Tgfbi UTSW 13 56629774 missense probably benign 0.00
R0122:Tgfbi UTSW 13 56627968 missense probably damaging 1.00
R0389:Tgfbi UTSW 13 56629702 missense probably benign 0.02
R0419:Tgfbi UTSW 13 56632193 splice site probably benign
R0432:Tgfbi UTSW 13 56632191 splice site probably benign
R0671:Tgfbi UTSW 13 56638726 missense probably null 1.00
R0825:Tgfbi UTSW 13 56638710 splice site probably benign
R1263:Tgfbi UTSW 13 56630655 missense probably damaging 1.00
R1597:Tgfbi UTSW 13 56632191 splice site probably benign
R1864:Tgfbi UTSW 13 56632881 missense probably benign 0.16
R1940:Tgfbi UTSW 13 56614314 missense possibly damaging 0.92
R2570:Tgfbi UTSW 13 56638708 splice site probably null
R3111:Tgfbi UTSW 13 56609734 missense probably damaging 1.00
R3613:Tgfbi UTSW 13 56625726 missense probably damaging 1.00
R4815:Tgfbi UTSW 13 56632120 missense probably benign 0.45
R5847:Tgfbi UTSW 13 56636605 missense possibly damaging 0.94
R6314:Tgfbi UTSW 13 56626163 missense probably benign 0.01
R6810:Tgfbi UTSW 13 56637203 missense probably benign
R6821:Tgfbi UTSW 13 56626137 missense possibly damaging 0.95
R6943:Tgfbi UTSW 13 56637176 missense possibly damaging 0.77
R7165:Tgfbi UTSW 13 56628016 missense probably damaging 0.99
R7770:Tgfbi UTSW 13 56632844 splice site probably null
R7910:Tgfbi UTSW 13 56632184 missense probably damaging 1.00
R7914:Tgfbi UTSW 13 56629689 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGACCTTGTCACAGAGTCC -3'
(R):5'- ACCAGAATTAGGTTACCTCTTGG -3'

Sequencing Primer
(F):5'- CAGAGTCCCTGTGTGATTTTACCAG -3'
(R):5'- AATTAGGTTACCTCTTGGGAAGTAG -3'
Posted On2019-06-26