Incidental Mutation 'R0636:Srsf2'
ID56699
Institutional Source Beutler Lab
Gene Symbol Srsf2
Ensembl Gene ENSMUSG00000034120
Gene Nameserine/arginine-rich splicing factor 2
SynonymsSfrs10, SC35, D11Wsu175e, Sfrs2, MRF-1
MMRRC Submission 038825-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0636 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116849901-116853094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116852078 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 206 (S206P)
Ref Sequence ENSEMBL: ENSMUSP00000140016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021173] [ENSMUST00000092404] [ENSMUST00000106363] [ENSMUST00000106365] [ENSMUST00000106370] [ENSMUST00000136012] [ENSMUST00000136914] [ENSMUST00000139954] [ENSMUST00000143184] [ENSMUST00000153084] [ENSMUST00000190993]
Predicted Effect probably benign
Transcript: ENSMUST00000021173
SMART Domains Protein: ENSMUSP00000021173
Gene: ENSMUSG00000020818

DomainStartEndE-ValueType
Pfam:UNC-93 14 166 6.5e-56 PFAM
transmembrane domain 173 190 N/A INTRINSIC
transmembrane domain 239 261 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
transmembrane domain 305 327 N/A INTRINSIC
transmembrane domain 410 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092404
AA Change: S206P

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090059
Gene: ENSMUSG00000034120
AA Change: S206P

DomainStartEndE-ValueType
RRM 15 88 1.79e-25 SMART
low complexity region 101 213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106363
SMART Domains Protein: ENSMUSP00000101971
Gene: ENSMUSG00000020818

DomainStartEndE-ValueType
Pfam:UNC-93 14 92 6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106365
SMART Domains Protein: ENSMUSP00000101973
Gene: ENSMUSG00000020818

DomainStartEndE-ValueType
Pfam:UNC-93 14 91 7.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106370
SMART Domains Protein: ENSMUSP00000101978
Gene: ENSMUSG00000090266

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Methyltransf_16 48 203 9.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126661
Predicted Effect probably benign
Transcript: ENSMUST00000132593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135135
Predicted Effect probably benign
Transcript: ENSMUST00000136012
SMART Domains Protein: ENSMUSP00000118203
Gene: ENSMUSG00000020818

DomainStartEndE-ValueType
Pfam:UNC-93 14 91 7.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136914
AA Change: S206P

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120086
Gene: ENSMUSG00000034120
AA Change: S206P

DomainStartEndE-ValueType
RRM 15 88 1.79e-25 SMART
low complexity region 101 213 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138484
Predicted Effect probably benign
Transcript: ENSMUST00000139954
SMART Domains Protein: ENSMUSP00000118112
Gene: ENSMUSG00000020818

DomainStartEndE-ValueType
Pfam:UNC-93 14 91 7.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140869
Predicted Effect probably benign
Transcript: ENSMUST00000143184
SMART Domains Protein: ENSMUSP00000119131
Gene: ENSMUSG00000090266

DomainStartEndE-ValueType
Pfam:Methyltransf_16 1 82 1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151944
Predicted Effect probably benign
Transcript: ENSMUST00000153084
SMART Domains Protein: ENSMUSP00000123368
Gene: ENSMUSG00000020818

DomainStartEndE-ValueType
Pfam:UNC-93 14 115 7.4e-33 PFAM
transmembrane domain 119 138 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 224 246 N/A INTRINSIC
transmembrane domain 253 275 N/A INTRINSIC
transmembrane domain 358 380 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176799
Predicted Effect unknown
Transcript: ENSMUST00000176834
AA Change: S3P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177429
Predicted Effect probably benign
Transcript: ENSMUST00000190993
AA Change: S206P

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140016
Gene: ENSMUSG00000034120
AA Change: S206P

DomainStartEndE-ValueType
RRM 15 88 1.79e-25 SMART
low complexity region 101 213 N/A INTRINSIC
Meta Mutation Damage Score 0.1107 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous mutants are embryonic lethal. Deaths occur prior to E7.5. Cre induced inactivation of this pre-mRNA splicing factor in the thymus impairs T-cell maturation. Inactivation in ventricular cardiomyocytes results in dilated cardiomyopathy without gross changes in cardiomyocyte development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,231,217 Y264C probably damaging Het
8030423J24Rik T C 13: 70,884,225 F139L unknown Het
Aco1 A G 4: 40,175,697 E146G probably damaging Het
Adam2 T G 14: 66,034,816 D639A probably benign Het
Adh4 G T 3: 138,428,074 R315L probably damaging Het
Adprhl1 T C 8: 13,248,702 D76G probably damaging Het
AF366264 T C 8: 13,837,870 R74G probably benign Het
Akip1 T C 7: 109,707,519 probably benign Het
Ap3d1 T A 10: 80,719,382 K370* probably null Het
Arfgef1 C A 1: 10,199,851 V358L probably benign Het
Arpp21 A T 9: 112,183,498 D85E probably benign Het
Azi2 A T 9: 118,062,057 L383F probably benign Het
Bpgm T A 6: 34,504,287 D206E probably benign Het
Bsn T C 9: 108,107,834 D3007G unknown Het
Ccdc142 T G 6: 83,107,198 probably benign Het
Cep135 T C 5: 76,615,657 V498A probably benign Het
Cntn6 A T 6: 104,863,148 Q1003L probably benign Het
Cntnap2 T A 6: 47,296,708 probably benign Het
Csf2rb2 G A 15: 78,291,960 Q139* probably null Het
Cyp3a16 A G 5: 145,463,085 V101A probably benign Het
D630045J12Rik T C 6: 38,196,778 T152A probably benign Het
Def8 G A 8: 123,454,357 W176* probably null Het
Dgkg A G 16: 22,579,729 probably benign Het
Ear10 T C 14: 43,922,994 probably null Het
Fbxw2 A T 2: 34,822,847 Y67* probably null Het
Flii T A 11: 60,715,552 Y1104F probably damaging Het
Gm973 G A 1: 59,551,144 R270K probably benign Het
Gm9833 T C 3: 10,088,783 L204P possibly damaging Het
Gnl3 T A 14: 31,017,153 K75N probably damaging Het
Gpc6 A T 14: 117,624,493 M274L probably benign Het
Ifi47 A G 11: 49,096,651 E415G possibly damaging Het
Ift57 A G 16: 49,711,896 T130A probably benign Het
Itpr2 T A 6: 146,171,412 D2373V probably damaging Het
Kat6a T C 8: 22,939,323 S1565P possibly damaging Het
Klhl6 A T 16: 19,948,073 probably benign Het
Klra2 T C 6: 131,220,104 probably benign Het
Lama5 A G 2: 180,189,331 probably null Het
Mapk4 A G 18: 73,930,454 S566P probably benign Het
Mindy4 C A 6: 55,276,585 R480S possibly damaging Het
Mterf3 T C 13: 66,922,753 probably benign Het
Mtmr2 A G 9: 13,801,913 probably null Het
Naip5 T C 13: 100,219,688 T1140A probably benign Het
Nf1 A G 11: 79,535,703 T1648A probably damaging Het
Nlk A T 11: 78,695,844 D141E probably benign Het
Noxa1 C A 2: 25,086,094 probably benign Het
Olfr1279 A G 2: 111,306,412 N69S probably benign Het
Olfr1480 A T 19: 13,530,249 Y236F possibly damaging Het
Olfr476 T C 7: 107,967,472 V25A probably benign Het
Otog G A 7: 46,264,228 probably null Het
Pebp4 T C 14: 70,048,347 probably benign Het
Phgdh G T 3: 98,333,291 N100K possibly damaging Het
Pnisr T A 4: 21,873,800 probably benign Het
Ptpn6 T C 6: 124,725,279 H346R probably benign Het
Rsf1 T C 7: 97,662,019 V652A possibly damaging Het
Rubcn G A 16: 32,828,686 H624Y probably damaging Het
Setdb2 T C 14: 59,406,704 N656D probably benign Het
Slc22a23 T C 13: 34,299,093 T268A probably benign Het
Slc3a1 A T 17: 85,032,794 T215S possibly damaging Het
Susd2 T A 10: 75,639,350 D542V probably damaging Het
Svep1 G A 4: 58,073,121 Q2063* probably null Het
Syne2 G A 12: 75,930,983 V1401M possibly damaging Het
Tenm2 A G 11: 36,943,976 L64P probably damaging Het
Tigd2 A G 6: 59,211,287 T380A possibly damaging Het
Trmt12 G T 15: 58,873,985 V411F probably damaging Het
Ubr4 T C 4: 139,436,302 probably null Het
Ush2a G A 1: 188,822,738 C3571Y probably benign Het
Usp8 A G 2: 126,720,110 M75V possibly damaging Het
Vcan C T 13: 89,704,706 D712N probably damaging Het
Vcan C A 13: 89,712,267 R327L probably damaging Het
Vps8 A G 16: 21,434,933 E8G probably benign Het
Washc5 T C 15: 59,359,409 D335G probably benign Het
Zbtb39 A G 10: 127,742,835 N426S probably benign Het
Zfp184 T A 13: 21,949,749 D55E probably damaging Het
Zfp882 T C 8: 71,914,337 V336A probably benign Het
Other mutations in Srsf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Srsf2 APN 11 116852270 unclassified probably benign
R1130:Srsf2 UTSW 11 116852183 unclassified probably benign
R6615:Srsf2 UTSW 11 116853079 utr 5 prime probably null
R7417:Srsf2 UTSW 11 116852901 missense probably damaging 0.99
R7663:Srsf2 UTSW 11 116852294 missense unknown
Z1177:Srsf2 UTSW 11 116852658 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GGTCTCAAACAGCATGAAACAGCCATT -3'
(R):5'- TCGCTCGCGCTCCAGATCAA -3'

Sequencing Primer
(F):5'- TCCCAAAGCTGAGTAACTTCAGAG -3'
(R):5'- GCTCCAGATCAACCTCCAAGTC -3'
Posted On2013-07-11