Incidental Mutation 'R0636:Dgkg'
ID56718
Institutional Source Beutler Lab
Gene Symbol Dgkg
Ensembl Gene ENSMUSG00000022861
Gene Namediacylglycerol kinase, gamma
SynonymsE430001K23Rik, 2900055E17Rik, Dagk3
MMRRC Submission 038825-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0636 (G1)
Quality Score221
Status Validated
Chromosome16
Chromosomal Location22468461-22657221 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 22579729 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023578] [ENSMUST00000089925] [ENSMUST00000137311]
Predicted Effect probably benign
Transcript: ENSMUST00000023578
SMART Domains Protein: ENSMUSP00000023578
Gene: ENSMUSG00000022861

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 2 172 9.3e-66 PFAM
EFh 176 204 8.13e-2 SMART
EFh 221 249 1.07e-1 SMART
C1 269 318 1.23e-10 SMART
DAGKc 392 516 5.29e-65 SMART
DAGKa 536 710 1.25e-116 SMART
low complexity region 735 748 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089925
SMART Domains Protein: ENSMUSP00000087371
Gene: ENSMUSG00000022861

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 5 172 3.9e-54 PFAM
EFh 176 204 8.13e-2 SMART
EFh 221 249 1.07e-1 SMART
C1 269 318 1.23e-10 SMART
C1 334 380 3.35e-3 SMART
DAGKc 431 555 5.29e-65 SMART
DAGKa 575 749 1.25e-116 SMART
low complexity region 774 787 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137311
SMART Domains Protein: ENSMUSP00000114441
Gene: ENSMUSG00000022861

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 2 172 3.8e-67 PFAM
EFh 176 204 8.13e-2 SMART
EFh 221 249 1.07e-1 SMART
C1 269 318 1.23e-10 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that is a member of the type I subfamily of diacylglycerol kinases, which are involved in lipid metabolism. These enzymes generate phosphatidic acid by catalyzing the phosphorylation of diacylglycerol, a fundamental lipid second messenger that activates numerous proteins, including protein kinase C isoforms, Ras guanyl nucleotide-releasing proteins and some transient receptor potential channels. Diacylglycerol kinase gamma has been implicated in cell cycle regulation and in the negative regulation of macrophage differentiation in leukemia cells. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,231,217 Y264C probably damaging Het
8030423J24Rik T C 13: 70,884,225 F139L unknown Het
Aco1 A G 4: 40,175,697 E146G probably damaging Het
Adam2 T G 14: 66,034,816 D639A probably benign Het
Adh4 G T 3: 138,428,074 R315L probably damaging Het
Adprhl1 T C 8: 13,248,702 D76G probably damaging Het
AF366264 T C 8: 13,837,870 R74G probably benign Het
Akip1 T C 7: 109,707,519 probably benign Het
Ap3d1 T A 10: 80,719,382 K370* probably null Het
Arfgef1 C A 1: 10,199,851 V358L probably benign Het
Arpp21 A T 9: 112,183,498 D85E probably benign Het
Azi2 A T 9: 118,062,057 L383F probably benign Het
Bpgm T A 6: 34,504,287 D206E probably benign Het
Bsn T C 9: 108,107,834 D3007G unknown Het
Ccdc142 T G 6: 83,107,198 probably benign Het
Cep135 T C 5: 76,615,657 V498A probably benign Het
Cntn6 A T 6: 104,863,148 Q1003L probably benign Het
Cntnap2 T A 6: 47,296,708 probably benign Het
Csf2rb2 G A 15: 78,291,960 Q139* probably null Het
Cyp3a16 A G 5: 145,463,085 V101A probably benign Het
D630045J12Rik T C 6: 38,196,778 T152A probably benign Het
Def8 G A 8: 123,454,357 W176* probably null Het
Ear10 T C 14: 43,922,994 probably null Het
Fbxw2 A T 2: 34,822,847 Y67* probably null Het
Flii T A 11: 60,715,552 Y1104F probably damaging Het
Gm973 G A 1: 59,551,144 R270K probably benign Het
Gm9833 T C 3: 10,088,783 L204P possibly damaging Het
Gnl3 T A 14: 31,017,153 K75N probably damaging Het
Gpc6 A T 14: 117,624,493 M274L probably benign Het
Ifi47 A G 11: 49,096,651 E415G possibly damaging Het
Ift57 A G 16: 49,711,896 T130A probably benign Het
Itpr2 T A 6: 146,171,412 D2373V probably damaging Het
Kat6a T C 8: 22,939,323 S1565P possibly damaging Het
Klhl6 A T 16: 19,948,073 probably benign Het
Klra2 T C 6: 131,220,104 probably benign Het
Lama5 A G 2: 180,189,331 probably null Het
Mapk4 A G 18: 73,930,454 S566P probably benign Het
Mindy4 C A 6: 55,276,585 R480S possibly damaging Het
Mterf3 T C 13: 66,922,753 probably benign Het
Mtmr2 A G 9: 13,801,913 probably null Het
Naip5 T C 13: 100,219,688 T1140A probably benign Het
Nf1 A G 11: 79,535,703 T1648A probably damaging Het
Nlk A T 11: 78,695,844 D141E probably benign Het
Noxa1 C A 2: 25,086,094 probably benign Het
Olfr1279 A G 2: 111,306,412 N69S probably benign Het
Olfr1480 A T 19: 13,530,249 Y236F possibly damaging Het
Olfr476 T C 7: 107,967,472 V25A probably benign Het
Otog G A 7: 46,264,228 probably null Het
Pebp4 T C 14: 70,048,347 probably benign Het
Phgdh G T 3: 98,333,291 N100K possibly damaging Het
Pnisr T A 4: 21,873,800 probably benign Het
Ptpn6 T C 6: 124,725,279 H346R probably benign Het
Rsf1 T C 7: 97,662,019 V652A possibly damaging Het
Rubcn G A 16: 32,828,686 H624Y probably damaging Het
Setdb2 T C 14: 59,406,704 N656D probably benign Het
Slc22a23 T C 13: 34,299,093 T268A probably benign Het
Slc3a1 A T 17: 85,032,794 T215S possibly damaging Het
Srsf2 A G 11: 116,852,078 S206P probably benign Het
Susd2 T A 10: 75,639,350 D542V probably damaging Het
Svep1 G A 4: 58,073,121 Q2063* probably null Het
Syne2 G A 12: 75,930,983 V1401M possibly damaging Het
Tenm2 A G 11: 36,943,976 L64P probably damaging Het
Tigd2 A G 6: 59,211,287 T380A possibly damaging Het
Trmt12 G T 15: 58,873,985 V411F probably damaging Het
Ubr4 T C 4: 139,436,302 probably null Het
Ush2a G A 1: 188,822,738 C3571Y probably benign Het
Usp8 A G 2: 126,720,110 M75V possibly damaging Het
Vcan C T 13: 89,704,706 D712N probably damaging Het
Vcan C A 13: 89,712,267 R327L probably damaging Het
Vps8 A G 16: 21,434,933 E8G probably benign Het
Washc5 T C 15: 59,359,409 D335G probably benign Het
Zbtb39 A G 10: 127,742,835 N426S probably benign Het
Zfp184 T A 13: 21,949,749 D55E probably damaging Het
Zfp882 T C 8: 71,914,337 V336A probably benign Het
Other mutations in Dgkg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Dgkg APN 16 22479362 splice site probably benign
IGL01347:Dgkg APN 16 22600590 missense probably benign 0.13
IGL02313:Dgkg APN 16 22570230 splice site probably benign
IGL02498:Dgkg APN 16 22548691 missense probably damaging 1.00
IGL02954:Dgkg APN 16 22622253 missense probably benign 0.00
IGL03103:Dgkg APN 16 22580525 missense probably damaging 1.00
R0014:Dgkg UTSW 16 22565364 splice site probably null
R0666:Dgkg UTSW 16 22562730 missense probably damaging 1.00
R1056:Dgkg UTSW 16 22600541 missense probably damaging 1.00
R1495:Dgkg UTSW 16 22500379 missense probably damaging 1.00
R1603:Dgkg UTSW 16 22570159 splice site probably benign
R1993:Dgkg UTSW 16 22600594 missense probably damaging 1.00
R2073:Dgkg UTSW 16 22565317 missense probably damaging 0.96
R2192:Dgkg UTSW 16 22588299 missense probably damaging 0.98
R2251:Dgkg UTSW 16 22622260 start codon destroyed probably null 0.98
R2252:Dgkg UTSW 16 22622260 start codon destroyed probably null 0.98
R3104:Dgkg UTSW 16 22575341 missense probably damaging 1.00
R3105:Dgkg UTSW 16 22575341 missense probably damaging 1.00
R3106:Dgkg UTSW 16 22575341 missense probably damaging 1.00
R4804:Dgkg UTSW 16 22575193 intron probably benign
R5272:Dgkg UTSW 16 22588294 splice site probably null
R5364:Dgkg UTSW 16 22600461 missense probably benign 0.03
R5417:Dgkg UTSW 16 22588331 missense possibly damaging 0.50
R5677:Dgkg UTSW 16 22570171 missense probably benign 0.00
R5839:Dgkg UTSW 16 22566494 missense possibly damaging 0.91
R5931:Dgkg UTSW 16 22558038 nonsense probably null
R6313:Dgkg UTSW 16 22519561 missense probably damaging 0.96
R7017:Dgkg UTSW 16 22572713 missense probably benign 0.31
R7135:Dgkg UTSW 16 22500382 missense probably damaging 1.00
R7326:Dgkg UTSW 16 22548690 missense probably damaging 1.00
R7476:Dgkg UTSW 16 22622304 start gained probably benign
R7812:Dgkg UTSW 16 22566415 missense probably damaging 1.00
Z1088:Dgkg UTSW 16 22469328 missense probably damaging 0.96
Z1088:Dgkg UTSW 16 22572686 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TCTGTTGCCTCACAGTGAGCAC -3'
(R):5'- GCAGAGTCATCCAGAAACAGATGCC -3'

Sequencing Primer
(F):5'- AAATTTCCCTTCACAACAGAGCAG -3'
(R):5'- AGATGCCAACGGACCCTTTG -3'
Posted On2013-07-11