Incidental Mutation 'R7325:Insig2'
ID568796
Institutional Source Beutler Lab
Gene Symbol Insig2
Ensembl Gene ENSMUSG00000003721
Gene Nameinsulin induced gene 2
SynonymsC730043J18Rik, Insig-2, 2900053I11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R7325 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location121304353-121332589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121306937 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 188 (V188A)
Ref Sequence ENSEMBL: ENSMUSP00000003818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003818] [ENSMUST00000071064] [ENSMUST00000159085] [ENSMUST00000160688] [ENSMUST00000160968] [ENSMUST00000162582] [ENSMUST00000162790] [ENSMUST00000186915]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003818
AA Change: V188A

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000003818
Gene: ENSMUSG00000003721
AA Change: V188A

DomainStartEndE-ValueType
Pfam:INSIG 28 211 9.2e-79 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000071064
AA Change: V188A

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065485
Gene: ENSMUSG00000003721
AA Change: V188A

DomainStartEndE-ValueType
Pfam:INSIG 28 211 9.2e-79 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159085
AA Change: V188A

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124345
Gene: ENSMUSG00000003721
AA Change: V188A

DomainStartEndE-ValueType
Pfam:INSIG 28 211 9.2e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160688
SMART Domains Protein: ENSMUSP00000123702
Gene: ENSMUSG00000003721

DomainStartEndE-ValueType
Pfam:INSIG 28 76 7.2e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160968
AA Change: V188A

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123747
Gene: ENSMUSG00000003721
AA Change: V188A

DomainStartEndE-ValueType
Pfam:INSIG 30 211 7.7e-50 PFAM
Predicted Effect silent
Transcript: ENSMUST00000162582
SMART Domains Protein: ENSMUSP00000125046
Gene: ENSMUSG00000003721

DomainStartEndE-ValueType
Pfam:INSIG 28 85 1.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162790
SMART Domains Protein: ENSMUSP00000124697
Gene: ENSMUSG00000003721

DomainStartEndE-ValueType
Pfam:INSIG 28 146 1.3e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000186915
AA Change: V80A

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140292
Gene: ENSMUSG00000003721
AA Change: V80A

DomainStartEndE-ValueType
Pfam:INSIG 1 103 1.1e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the protein product encoded by gene INSIG1. Both INSIG1 protein and this protein are endoplasmic reticulum proteins that block the processing of sterol regulatory element binding proteins (SREBPs) by binding to SREBP cleavage-activating protein (SCAP), and thus prevent SCAP from escorting SREBPs to the Golgi. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,532,630 Q402L probably benign Het
Afap1l1 T C 18: 61,736,846 T638A probably benign Het
Agtr1a A C 13: 30,381,907 K318N possibly damaging Het
Anks1b A G 10: 90,941,432 T1095A probably damaging Het
Ap3d1 A T 10: 80,723,803 I207N probably damaging Het
Arhgef11 T C 3: 87,713,292 L484P possibly damaging Het
Astn2 C T 4: 65,542,669 S1076N probably benign Het
Baat C A 4: 49,490,213 L290F probably benign Het
Boll T C 1: 55,304,598 Y222C probably damaging Het
Bphl A T 13: 34,050,341 I147F possibly damaging Het
C330027C09Rik T A 16: 49,005,821 M417K probably benign Het
Cadps2 T G 6: 23,409,935 D766A unknown Het
Cd300lb T A 11: 114,925,032 K210M probably damaging Het
Cdan1 T C 2: 120,724,704 Q797R probably benign Het
Celsr1 T A 15: 86,033,008 S255C probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Dennd5b T A 6: 149,020,570 K815N probably benign Het
Exd1 A G 2: 119,520,139 V547A probably benign Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fip1l1 A G 5: 74,536,799 probably null Het
Flg2 T A 3: 93,203,372 N902K unknown Het
Fyttd1 T A 16: 32,884,248 N76K probably benign Het
Gins1 T A 2: 150,916,166 D57E probably benign Het
Gm5565 G C 5: 146,158,361 probably null Het
Gm6614 T C 6: 141,989,225 K379E probably damaging Het
Gpsm2 T C 3: 108,702,928 Y72C probably damaging Het
Hace1 C A 10: 45,589,507 S53* probably null Het
Ism1 T C 2: 139,757,043 V312A probably damaging Het
Jmy A T 13: 93,472,743 Y353N probably damaging Het
Maats1 T A 16: 38,321,601 probably null Het
Maz A C 7: 127,025,553 V265G probably benign Het
Mtmr14 T A 6: 113,269,548 I426N probably damaging Het
Olfr1054 A G 2: 86,333,000 S119P possibly damaging Het
Olfr1467 A G 19: 13,364,637 E3G probably benign Het
Olfr394 C T 11: 73,888,275 M32I probably benign Het
Pcdhac2 T A 18: 37,145,360 N464K probably damaging Het
Pcdhb7 T A 18: 37,343,387 H525Q probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Podn C T 4: 108,017,702 probably null Het
Prim1 A G 10: 128,022,919 D232G probably null Het
Prrt1 T A 17: 34,632,187 M283K possibly damaging Het
Rgs9 A T 11: 109,276,581 I65N probably damaging Het
Scgb2b26 C A 7: 33,944,357 V53L probably benign Het
Shank2 C A 7: 144,411,685 P1010Q probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc17a6 G T 7: 51,645,018 A158S probably damaging Het
Slc9a9 C T 9: 94,712,898 H154Y probably benign Het
Slco2a1 T A 9: 103,085,749 probably null Het
Snapc3 T C 4: 83,435,270 I182T probably benign Het
Taok2 A G 7: 126,871,088 V856A probably benign Het
Tep1 T A 14: 50,866,038 N265I probably damaging Het
Tespa1 A T 10: 130,362,041 N311Y probably damaging Het
Tpmt G A 13: 47,041,484 Q14* probably null Het
Trim33 T C 3: 103,321,636 F353L possibly damaging Het
Upp1 T C 11: 9,134,743 V154A probably damaging Het
Usp34 T C 11: 23,419,052 I1747T Het
Vmn1r47 T C 6: 90,022,272 S129P probably benign Het
Vmn2r93 A G 17: 18,303,987 Y81C probably benign Het
Ybx2 A T 11: 69,940,355 T259S probably benign Het
Zfp536 T C 7: 37,479,860 T1107A probably benign Het
Zfp583 C T 7: 6,316,586 A476T probably damaging Het
Other mutations in Insig2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Insig2 APN 1 121305947 missense probably damaging 1.00
IGL03038:Insig2 APN 1 121319674 missense probably damaging 1.00
R0037:Insig2 UTSW 1 121306920 missense probably damaging 1.00
R1458:Insig2 UTSW 1 121307156 missense probably benign 0.07
R4544:Insig2 UTSW 1 121312192 splice site probably benign
R5077:Insig2 UTSW 1 121312235 missense probably damaging 0.98
R7839:Insig2 UTSW 1 121312320 missense probably benign 0.01
R7922:Insig2 UTSW 1 121312320 missense probably benign 0.01
X0061:Insig2 UTSW 1 121306963 missense probably damaging 0.99
X0066:Insig2 UTSW 1 121305949 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGGTCAACAAATTCTACCATCCTAC -3'
(R):5'- CTTAGCAACCGTTGTCACCC -3'

Sequencing Primer
(F):5'- ACCATCCTACCCATAACCTATTTTTC -3'
(R):5'- GTCACCCAACTGTTAGTCTACAATGG -3'
Posted On2019-09-13