Incidental Mutation 'R7325:Jmy'
ID568840
Institutional Source Beutler Lab
Gene Symbol Jmy
Ensembl Gene ENSMUSG00000021690
Gene Namejunction-mediating and regulatory protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R7325 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location93430101-93499808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93472743 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 353 (Y353N)
Ref Sequence ENSEMBL: ENSMUSP00000070339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065537] [ENSMUST00000220513]
Predicted Effect probably damaging
Transcript: ENSMUST00000065537
AA Change: Y353N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070339
Gene: ENSMUSG00000021690
AA Change: Y353N

DomainStartEndE-ValueType
Pfam:WHAMM-JMY_N 5 55 6.2e-30 PFAM
low complexity region 77 94 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
low complexity region 152 181 N/A INTRINSIC
low complexity region 202 217 N/A INTRINSIC
Pfam:JMY 220 574 2.2e-175 PFAM
SCOP:d1jvr__ 794 816 4e-3 SMART
WH2 916 933 2.21e-2 SMART
low complexity region 964 975 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220513
AA Change: Y353N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,532,630 Q402L probably benign Het
Afap1l1 T C 18: 61,736,846 T638A probably benign Het
Agtr1a A C 13: 30,381,907 K318N possibly damaging Het
Anks1b A G 10: 90,941,432 T1095A probably damaging Het
Ap3d1 A T 10: 80,723,803 I207N probably damaging Het
Arhgef11 T C 3: 87,713,292 L484P possibly damaging Het
Astn2 C T 4: 65,542,669 S1076N probably benign Het
Baat C A 4: 49,490,213 L290F probably benign Het
Boll T C 1: 55,304,598 Y222C probably damaging Het
Bphl A T 13: 34,050,341 I147F possibly damaging Het
C330027C09Rik T A 16: 49,005,821 M417K probably benign Het
Cadps2 T G 6: 23,409,935 D766A unknown Het
Cd300lb T A 11: 114,925,032 K210M probably damaging Het
Cdan1 T C 2: 120,724,704 Q797R probably benign Het
Celsr1 T A 15: 86,033,008 S255C probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Dennd5b T A 6: 149,020,570 K815N probably benign Het
Exd1 A G 2: 119,520,139 V547A probably benign Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fip1l1 A G 5: 74,536,799 probably null Het
Flg2 T A 3: 93,203,372 N902K unknown Het
Fyttd1 T A 16: 32,884,248 N76K probably benign Het
Gins1 T A 2: 150,916,166 D57E probably benign Het
Gm5565 G C 5: 146,158,361 probably null Het
Gm6614 T C 6: 141,989,225 K379E probably damaging Het
Gpsm2 T C 3: 108,702,928 Y72C probably damaging Het
Hace1 C A 10: 45,589,507 S53* probably null Het
Insig2 A G 1: 121,306,937 V188A possibly damaging Het
Ism1 T C 2: 139,757,043 V312A probably damaging Het
Maats1 T A 16: 38,321,601 probably null Het
Maz A C 7: 127,025,553 V265G probably benign Het
Mtmr14 T A 6: 113,269,548 I426N probably damaging Het
Olfr1054 A G 2: 86,333,000 S119P possibly damaging Het
Olfr1467 A G 19: 13,364,637 E3G probably benign Het
Olfr394 C T 11: 73,888,275 M32I probably benign Het
Pcdhac2 T A 18: 37,145,360 N464K probably damaging Het
Pcdhb7 T A 18: 37,343,387 H525Q probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Podn C T 4: 108,017,702 probably null Het
Prim1 A G 10: 128,022,919 D232G probably null Het
Prrt1 T A 17: 34,632,187 M283K possibly damaging Het
Rgs9 A T 11: 109,276,581 I65N probably damaging Het
Scgb2b26 C A 7: 33,944,357 V53L probably benign Het
Shank2 C A 7: 144,411,685 P1010Q probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc17a6 G T 7: 51,645,018 A158S probably damaging Het
Slc9a9 C T 9: 94,712,898 H154Y probably benign Het
Slco2a1 T A 9: 103,085,749 probably null Het
Snapc3 T C 4: 83,435,270 I182T probably benign Het
Taok2 A G 7: 126,871,088 V856A probably benign Het
Tep1 T A 14: 50,866,038 N265I probably damaging Het
Tespa1 A T 10: 130,362,041 N311Y probably damaging Het
Tpmt G A 13: 47,041,484 Q14* probably null Het
Trim33 T C 3: 103,321,636 F353L possibly damaging Het
Upp1 T C 11: 9,134,743 V154A probably damaging Het
Usp34 T C 11: 23,419,052 I1747T Het
Vmn1r47 T C 6: 90,022,272 S129P probably benign Het
Vmn2r93 A G 17: 18,303,987 Y81C probably benign Het
Ybx2 A T 11: 69,940,355 T259S probably benign Het
Zfp536 T C 7: 37,479,860 T1107A probably benign Het
Zfp583 C T 7: 6,316,586 A476T probably damaging Het
Other mutations in Jmy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Jmy APN 13 93441402 missense probably benign 0.00
IGL00949:Jmy APN 13 93454002 missense probably damaging 1.00
IGL01111:Jmy APN 13 93441021 missense probably damaging 1.00
IGL01734:Jmy APN 13 93459651 missense probably damaging 1.00
IGL01926:Jmy APN 13 93459786 missense probably damaging 1.00
IGL01985:Jmy APN 13 93459636 missense possibly damaging 0.58
IGL02183:Jmy APN 13 93499242 missense possibly damaging 0.78
IGL02517:Jmy APN 13 93452808 missense probably benign 0.01
IGL02524:Jmy APN 13 93472760 missense probably damaging 1.00
IGL02697:Jmy APN 13 93459701 nonsense probably null
IGL03024:Jmy APN 13 93499199 missense probably damaging 1.00
R0242:Jmy UTSW 13 93441618 missense probably benign 0.07
R0242:Jmy UTSW 13 93441618 missense probably benign 0.07
R0623:Jmy UTSW 13 93452817 missense probably benign 0.37
R0623:Jmy UTSW 13 93452817 missense probably benign 0.37
R0722:Jmy UTSW 13 93452817 missense probably benign 0.37
R1533:Jmy UTSW 13 93441311 missense probably benign
R1667:Jmy UTSW 13 93498370 missense probably damaging 1.00
R1737:Jmy UTSW 13 93498795 missense probably damaging 0.99
R1815:Jmy UTSW 13 93454077 missense probably damaging 1.00
R2057:Jmy UTSW 13 93459703 missense probably damaging 1.00
R3522:Jmy UTSW 13 93454050 missense probably damaging 1.00
R3765:Jmy UTSW 13 93464711 missense possibly damaging 0.78
R4231:Jmy UTSW 13 93498925 missense probably benign
R4279:Jmy UTSW 13 93498882 missense probably damaging 1.00
R4279:Jmy UTSW 13 93499273 missense probably damaging 1.00
R4330:Jmy UTSW 13 93498882 missense probably damaging 1.00
R4330:Jmy UTSW 13 93499273 missense probably damaging 1.00
R4845:Jmy UTSW 13 93439738 missense possibly damaging 0.80
R5047:Jmy UTSW 13 93441572 missense possibly damaging 0.65
R5403:Jmy UTSW 13 93441396 missense probably benign 0.08
R5941:Jmy UTSW 13 93498825 missense probably benign
R5953:Jmy UTSW 13 93499116 missense possibly damaging 0.62
R6022:Jmy UTSW 13 93453578 splice site probably null
R6150:Jmy UTSW 13 93441133 missense probably benign 0.10
R6520:Jmy UTSW 13 93454039 missense probably benign 0.10
R7073:Jmy UTSW 13 93441333 missense probably benign 0.01
R7074:Jmy UTSW 13 93453931 missense probably benign 0.15
R7575:Jmy UTSW 13 93464595 nonsense probably null
R7641:Jmy UTSW 13 93442599 missense probably damaging 1.00
R7674:Jmy UTSW 13 93442599 missense probably damaging 1.00
R7862:Jmy UTSW 13 93499195 missense possibly damaging 0.75
R7945:Jmy UTSW 13 93499195 missense possibly damaging 0.75
Z1088:Jmy UTSW 13 93441081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGAGTGGCTACAGTTTAG -3'
(R):5'- GCAGGTAGTAGTTCTTTCCCTC -3'

Sequencing Primer
(F):5'- CTCGGAATGGCTGAAGTA -3'
(R):5'- GTGACCTTGTACATTGAGACAC -3'
Posted On2019-09-13