Incidental Mutation 'R7359:Simc1'
ID 571218
Institutional Source Beutler Lab
Gene Symbol Simc1
Ensembl Gene ENSMUSG00000043183
Gene Name SUMO-interacting motifs containing 1
Synonyms 4732471D19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R7359 (G1)
Quality Score 203.009
Status Validated
Chromosome 13
Chromosomal Location 54503779-54551290 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54503918 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 15 (S15G)
Ref Sequence ENSEMBL: ENSMUSP00000124921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118072] [ENSMUST00000121401] [ENSMUST00000138869] [ENSMUST00000159721]
AlphaFold E9Q6E9
Predicted Effect probably benign
Transcript: ENSMUST00000118072
AA Change: S15G

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112376
Gene: ENSMUSG00000043183
AA Change: S15G

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 167 179 N/A INTRINSIC
low complexity region 378 392 N/A INTRINSIC
low complexity region 425 443 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121401
AA Change: S15G
SMART Domains Protein: ENSMUSP00000113676
Gene: ENSMUSG00000043183
AA Change: S15G

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 173 189 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
internal_repeat_1 268 491 3.21e-17 PROSPERO
internal_repeat_1 579 832 3.21e-17 PROSPERO
low complexity region 852 868 N/A INTRINSIC
low complexity region 1068 1080 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1326 1344 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000138869
AA Change: S15G
SMART Domains Protein: ENSMUSP00000124474
Gene: ENSMUSG00000043183
AA Change: S15G

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000159721
AA Change: S15G
SMART Domains Protein: ENSMUSP00000124921
Gene: ENSMUSG00000043183
AA Change: S15G

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 99% (87/88)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,189,574 V1233A possibly damaging Het
Abcc9 G A 6: 142,671,682 T552I probably damaging Het
Adgrf4 T C 17: 42,667,112 I447V possibly damaging Het
Akirin2 T A 4: 34,565,944 D178E probably damaging Het
Arhgap12 T C 18: 6,065,709 E359G possibly damaging Het
Arhgef5 A C 6: 43,280,282 T1256P probably damaging Het
Avpr1a A C 10: 122,449,378 I192L possibly damaging Het
B4galnt4 A G 7: 141,071,284 H926R probably damaging Het
BC067074 T C 13: 113,342,430 S1503P Het
Bean1 CT C 8: 104,182,032 probably null Het
Ccdc68 C T 18: 69,956,052 A222V probably benign Het
Cdc23 T C 18: 34,641,341 Y295C probably benign Het
Ceacam10 T C 7: 24,781,007 Y188H unknown Het
Cfap57 T A 4: 118,598,965 T511S probably benign Het
Cftr T C 6: 18,221,624 V245A probably benign Het
Cit A G 5: 115,926,574 D505G probably damaging Het
Cmah T G 13: 24,468,556 N556K probably benign Het
D430041D05Rik C A 2: 104,214,137 D839Y probably damaging Het
Dek T C 13: 47,105,589 D47G unknown Het
Des C T 1: 75,360,952 R179C probably damaging Het
Desi2 A G 1: 178,187,943 N10D probably benign Het
Dlg5 T C 14: 24,164,547 N679S probably damaging Het
Dnajc24 T C 2: 106,001,948 Y30C probably damaging Het
Dock10 T A 1: 80,709,348 H34L probably benign Het
Dock5 A G 14: 67,765,888 V1586A probably benign Het
Dpy19l4 A G 4: 11,273,125 V576A probably benign Het
Dusp6 A G 10: 99,264,065 E125G probably benign Het
Dync1h1 T C 12: 110,624,602 Y1035H probably benign Het
Dysf G A 6: 84,195,324 probably null Het
En1 A G 1: 120,607,088 K369E unknown Het
F2r A G 13: 95,604,686 Y114H probably damaging Het
Fam184a T C 10: 53,699,222 Y97C probably damaging Het
Fggy T C 4: 95,769,480 V286A probably benign Het
Flot2 T C 11: 78,058,557 I322T probably benign Het
Fndc1 A T 17: 7,813,486 probably null Het
Frs3 A G 17: 47,699,525 D28G probably damaging Het
Gimap3 C T 6: 48,765,346 D217N probably benign Het
Gm128 A G 3: 95,240,623 V120A probably benign Het
Gm14548 T A 7: 3,898,104 probably benign Het
Gm17190 T C 13: 96,082,462 V102A probably damaging Het
Gm17268 A G 11: 82,028,231 V20A unknown Het
Grsf1 A T 5: 88,665,564 probably null Het
Hmcn2 A T 2: 31,388,383 Y1699F probably benign Het
Hnmt T A 2: 24,048,719 M36L probably benign Het
Hoxd1 C A 2: 74,764,103 T234K probably damaging Het
Hydin C G 8: 110,506,101 S1679R probably damaging Het
Jag1 T C 2: 137,084,306 R1059G probably benign Het
Kbtbd11 T C 8: 15,028,858 W486R probably damaging Het
Kcnh6 A G 11: 106,018,963 D438G possibly damaging Het
Lgals4 T G 7: 28,841,299 F276V probably benign Het
Lrp6 G T 6: 134,450,960 Y1556* probably null Het
Mpdz G A 4: 81,356,395 L855F probably benign Het
Muc16 A T 9: 18,643,020 D3992E unknown Het
Npc1 T C 18: 12,195,180 N1024S probably benign Het
Nsfl1c A G 2: 151,494,359 T18A probably benign Het
Olfr1120 T A 2: 87,358,211 L256I possibly damaging Het
Olfr130 G A 17: 38,067,615 W148* probably null Het
Olfr358 A T 2: 37,005,437 M59K probably damaging Het
Olfr949-ps1 T C 9: 39,365,479 *307R probably null Het
Pcdh15 A T 10: 74,584,216 K1235N probably damaging Het
Pcif1 A G 2: 164,884,331 K51E probably damaging Het
Pde1b G A 15: 103,521,325 D82N probably damaging Het
Phf23 T A 11: 69,998,641 V167E possibly damaging Het
Pik3c2g T C 6: 139,967,894 V1006A unknown Het
Pkhd1l1 G T 15: 44,589,486 V3936F probably damaging Het
Pnpla1 T C 17: 28,881,185 V342A probably benign Het
Ppip5k1 T C 2: 121,340,848 D620G possibly damaging Het
Ppl A G 16: 5,089,341 L1030P possibly damaging Het
Prelid1 A T 13: 55,321,275 probably benign Het
Racgap1 C T 15: 99,631,200 S264N probably benign Het
Rdh13 T C 7: 4,427,697 D289G probably benign Het
Rtp3 T C 9: 110,986,296 I334V probably benign Het
Setd2 A T 9: 110,562,944 D200V Het
Sirpb1c A T 3: 15,833,225 M150K probably benign Het
Smoc1 T A 12: 81,150,701 D202E probably damaging Het
Spata31d1b A G 13: 59,712,490 Y59C probably damaging Het
Stard9 A G 2: 120,698,280 T1673A probably damaging Het
Tbc1d31 T A 15: 57,916,108 H72Q probably benign Het
Tgfbrap1 C A 1: 43,075,533 V136L probably damaging Het
Top2b A G 14: 16,407,376 N720S probably null Het
Vmn1r11 T C 6: 57,138,199 S283P probably damaging Het
Vmn1r19 A G 6: 57,405,095 H211R probably damaging Het
Vmn2r44 A T 7: 8,367,539 M836K probably benign Het
Vmn2r61 A C 7: 42,265,983 H118P probably benign Het
Vps33a A G 5: 123,558,633 I319T probably benign Het
Vwf T A 6: 125,566,257 S151T Het
Zfp423 T C 8: 87,782,243 N491S possibly damaging Het
Zfp626 T C 7: 27,808,235 F23S probably damaging Het
Other mutations in Simc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Simc1 APN 13 54525176 missense probably benign 0.27
IGL00813:Simc1 APN 13 54546986 missense probably damaging 0.98
IGL01326:Simc1 APN 13 54524660 missense probably benign 0.00
IGL01587:Simc1 APN 13 54539704 missense probably damaging 1.00
IGL02887:Simc1 APN 13 54525258 missense probably benign 0.04
IGL02977:Simc1 APN 13 54526307 missense probably benign 0.15
IGL03051:Simc1 APN 13 54526223 missense probably benign 0.15
IGL03065:Simc1 APN 13 54537212 missense probably damaging 1.00
IGL03244:Simc1 APN 13 54550629 missense probably benign 0.06
R0158:Simc1 UTSW 13 54524717 missense probably benign 0.00
R0218:Simc1 UTSW 13 54526604 missense probably damaging 1.00
R0241:Simc1 UTSW 13 54550525 missense probably damaging 1.00
R0241:Simc1 UTSW 13 54550525 missense probably damaging 1.00
R0362:Simc1 UTSW 13 54528467 missense probably damaging 1.00
R0464:Simc1 UTSW 13 54537100 nonsense probably null
R0556:Simc1 UTSW 13 54525347 missense probably benign 0.16
R0616:Simc1 UTSW 13 54547032 missense probably benign 0.03
R0686:Simc1 UTSW 13 54525190 missense probably benign 0.31
R0715:Simc1 UTSW 13 54525655 missense possibly damaging 0.49
R0761:Simc1 UTSW 13 54526574 missense probably damaging 1.00
R1335:Simc1 UTSW 13 54525265 intron probably benign
R1344:Simc1 UTSW 13 54550479 missense probably damaging 1.00
R1345:Simc1 UTSW 13 54525247 intron probably benign
R1585:Simc1 UTSW 13 54525258 missense probably benign 0.04
R1633:Simc1 UTSW 13 54525231 missense probably benign 0.05
R1725:Simc1 UTSW 13 54526406 missense probably damaging 0.99
R1826:Simc1 UTSW 13 54524639 missense probably benign 0.00
R1827:Simc1 UTSW 13 54524639 missense probably benign 0.00
R1893:Simc1 UTSW 13 54539715 missense probably damaging 0.99
R2012:Simc1 UTSW 13 54503888 missense probably benign 0.05
R2088:Simc1 UTSW 13 54541534 missense probably damaging 1.00
R2901:Simc1 UTSW 13 54541518 splice site probably null
R2974:Simc1 UTSW 13 54550461 missense probably damaging 1.00
R4238:Simc1 UTSW 13 54526260 nonsense probably null
R4870:Simc1 UTSW 13 54539763 missense probably null 0.73
R4959:Simc1 UTSW 13 54525318 missense possibly damaging 0.49
R5104:Simc1 UTSW 13 54526362 missense probably benign 0.15
R5217:Simc1 UTSW 13 54539896 unclassified probably benign
R5319:Simc1 UTSW 13 54524982 missense probably benign 0.00
R5635:Simc1 UTSW 13 54525404 missense probably benign 0.00
R5660:Simc1 UTSW 13 54547089 missense probably benign 0.01
R5900:Simc1 UTSW 13 54547024 missense probably damaging 1.00
R5963:Simc1 UTSW 13 54525819 missense possibly damaging 0.84
R6036:Simc1 UTSW 13 54524621 missense probably benign 0.01
R6036:Simc1 UTSW 13 54524621 missense probably benign 0.01
R6089:Simc1 UTSW 13 54528490 missense probably benign 0.30
R6271:Simc1 UTSW 13 54539724 missense probably damaging 1.00
R6322:Simc1 UTSW 13 54550569 missense probably damaging 1.00
R6364:Simc1 UTSW 13 54524600 nonsense probably null
R6434:Simc1 UTSW 13 54526664 missense probably benign 0.22
R6627:Simc1 UTSW 13 54547074 missense probably damaging 1.00
R6758:Simc1 UTSW 13 54525548 missense possibly damaging 0.57
R7236:Simc1 UTSW 13 54524796 missense probably benign 0.03
R7297:Simc1 UTSW 13 54525235 intron probably benign
R7362:Simc1 UTSW 13 54539704 missense probably damaging 1.00
R7490:Simc1 UTSW 13 54524349 missense possibly damaging 0.84
R7792:Simc1 UTSW 13 54547330 missense probably damaging 1.00
R7855:Simc1 UTSW 13 54524832 missense probably benign 0.03
R7869:Simc1 UTSW 13 54503900 missense unknown
R8293:Simc1 UTSW 13 54526546 missense probably damaging 0.98
R8330:Simc1 UTSW 13 54525364 intron probably benign
R8692:Simc1 UTSW 13 54525380 missense probably benign 0.16
R9087:Simc1 UTSW 13 54524334 missense probably benign 0.03
R9449:Simc1 UTSW 13 54526379 missense probably benign 0.15
X0023:Simc1 UTSW 13 54541531 missense probably damaging 0.98
Z1177:Simc1 UTSW 13 54524445 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCTGTGACACTGCCCTGAC -3'
(R):5'- ACATCTGTGCCCATCATAAGC -3'

Sequencing Primer
(F):5'- CGAGATAGGCGGGGCTC -3'
(R):5'- CTCAGTGTGTCGCCCATGTG -3'
Posted On 2019-09-13