Incidental Mutation 'R7359:Hmcn2'
ID571160
Institutional Source Beutler Lab
Gene Symbol Hmcn2
Ensembl Gene ENSMUSG00000055632
Gene Namehemicentin 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7359 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location31314415-31460738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31388383 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1699 (Y1699F)
Ref Sequence ENSEMBL: ENSMUSP00000109160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113532] [ENSMUST00000226996]
Predicted Effect probably benign
Transcript: ENSMUST00000113532
AA Change: Y1699F

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109160
Gene: ENSMUSG00000055632
AA Change: Y1699F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 37 211 1.21e-1 SMART
Blast:IG_like 263 340 2e-38 BLAST
IG 434 515 7.36e-2 SMART
IGc2 530 595 1.91e-9 SMART
IGc2 621 685 4.81e-15 SMART
IGc2 711 773 1.09e-13 SMART
IGc2 799 866 2.72e-14 SMART
IGc2 894 959 1.95e-15 SMART
IGc2 985 1049 5e-13 SMART
IGc2 1082 1147 1.09e-13 SMART
low complexity region 1151 1169 N/A INTRINSIC
IGc2 1173 1232 7.07e-13 SMART
IGc2 1260 1326 4.31e-17 SMART
IGc2 1354 1428 3e-16 SMART
IGc2 1456 1522 1.82e-15 SMART
IGc2 1550 1615 2.7e-18 SMART
IGc2 1644 1708 1.3e-11 SMART
IGc2 1736 1801 6.69e-14 SMART
IG 1826 1917 2.31e0 SMART
IGc2 1932 1997 4.62e-17 SMART
IGc2 2024 2091 3.25e-12 SMART
IGc2 2117 2182 1.28e-10 SMART
IGc2 2209 2276 3.76e-8 SMART
IGc2 2305 2370 2.6e-11 SMART
IGc2 2399 2464 1.32e-12 SMART
IGc2 2492 2557 2.06e-14 SMART
IGc2 2588 2653 3.9e-15 SMART
IGc2 2686 2751 2.64e-12 SMART
IGc2 2797 2862 9.05e-11 SMART
IGc2 2892 2957 4.7e-9 SMART
IGc2 2984 3049 1.44e-13 SMART
IGc2 3079 3144 9.33e-13 SMART
IGc2 3171 3236 3.79e-13 SMART
IGc2 3264 3331 1.85e-16 SMART
IGc2 3360 3425 9.61e-15 SMART
low complexity region 3433 3445 N/A INTRINSIC
IGc2 3453 3514 5.83e-14 SMART
IGc2 3542 3600 1.76e-8 SMART
low complexity region 3613 3627 N/A INTRINSIC
IGc2 3628 3693 5.2e-11 SMART
IGc2 3719 3784 2.64e-12 SMART
IGc2 3810 3877 3.35e-5 SMART
IGc2 3903 3968 3.73e-12 SMART
IGc2 3994 4058 4.39e-9 SMART
IGc2 4084 4149 1.79e-14 SMART
low complexity region 4157 4169 N/A INTRINSIC
IGc2 4175 4238 9.33e-13 SMART
IGc2 4265 4329 7.22e-19 SMART
IGc2 4355 4419 1.59e-15 SMART
Pfam:G2F 4431 4613 1.7e-56 PFAM
EGF_CA 4668 4708 5.78e-11 SMART
EGF_CA 4709 4753 9.39e-11 SMART
EGF_CA 4754 4796 7.69e-7 SMART
EGF_CA 4797 4837 2.19e-11 SMART
EGF_CA 4904 4943 6.74e-12 SMART
EGF_like 4944 4989 1.87e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226996
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 99% (87/88)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,189,574 V1233A possibly damaging Het
Abcc9 G A 6: 142,671,682 T552I probably damaging Het
Adgrf4 T C 17: 42,667,112 I447V possibly damaging Het
Akirin2 T A 4: 34,565,944 D178E probably damaging Het
Arhgap12 T C 18: 6,065,709 E359G possibly damaging Het
Arhgef5 A C 6: 43,280,282 T1256P probably damaging Het
Avpr1a A C 10: 122,449,378 I192L possibly damaging Het
B4galnt4 A G 7: 141,071,284 H926R probably damaging Het
BC067074 T C 13: 113,342,430 S1503P Het
Bean1 CT C 8: 104,182,032 probably null Het
Ccdc68 C T 18: 69,956,052 A222V probably benign Het
Cdc23 T C 18: 34,641,341 Y295C probably benign Het
Ceacam10 T C 7: 24,781,007 Y188H unknown Het
Cfap57 T A 4: 118,598,965 T511S probably benign Het
Cftr T C 6: 18,221,624 V245A probably benign Het
Cit A G 5: 115,926,574 D505G probably damaging Het
Cmah T G 13: 24,468,556 N556K probably benign Het
D430041D05Rik C A 2: 104,214,137 D839Y probably damaging Het
Dek T C 13: 47,105,589 D47G unknown Het
Des C T 1: 75,360,952 R179C probably damaging Het
Desi2 A G 1: 178,187,943 N10D probably benign Het
Dlg5 T C 14: 24,164,547 N679S probably damaging Het
Dnajc24 T C 2: 106,001,948 Y30C probably damaging Het
Dock10 T A 1: 80,709,348 H34L probably benign Het
Dock5 A G 14: 67,765,888 V1586A probably benign Het
Dpy19l4 A G 4: 11,273,125 V576A probably benign Het
Dusp6 A G 10: 99,264,065 E125G probably benign Het
Dync1h1 T C 12: 110,624,602 Y1035H probably benign Het
Dysf G A 6: 84,195,324 probably null Het
En1 A G 1: 120,607,088 K369E unknown Het
F2r A G 13: 95,604,686 Y114H probably damaging Het
Fam184a T C 10: 53,699,222 Y97C probably damaging Het
Fggy T C 4: 95,769,480 V286A probably benign Het
Flot2 T C 11: 78,058,557 I322T probably benign Het
Fndc1 A T 17: 7,813,486 probably null Het
Frs3 A G 17: 47,699,525 D28G probably damaging Het
Gimap3 C T 6: 48,765,346 D217N probably benign Het
Gm128 A G 3: 95,240,623 V120A probably benign Het
Gm14548 T A 7: 3,898,104 probably benign Het
Gm17190 T C 13: 96,082,462 V102A probably damaging Het
Gm17268 A G 11: 82,028,231 V20A unknown Het
Grsf1 A T 5: 88,665,564 probably null Het
Hnmt T A 2: 24,048,719 M36L probably benign Het
Hoxd1 C A 2: 74,764,103 T234K probably damaging Het
Hydin C G 8: 110,506,101 S1679R probably damaging Het
Jag1 T C 2: 137,084,306 R1059G probably benign Het
Kbtbd11 T C 8: 15,028,858 W486R probably damaging Het
Kcnh6 A G 11: 106,018,963 D438G possibly damaging Het
Lgals4 T G 7: 28,841,299 F276V probably benign Het
Lrp6 G T 6: 134,450,960 Y1556* probably null Het
Mpdz G A 4: 81,356,395 L855F probably benign Het
Muc16 A T 9: 18,643,020 D3992E unknown Het
Npc1 T C 18: 12,195,180 N1024S probably benign Het
Nsfl1c A G 2: 151,494,359 T18A probably benign Het
Olfr1120 T A 2: 87,358,211 L256I possibly damaging Het
Olfr130 G A 17: 38,067,615 W148* probably null Het
Olfr358 A T 2: 37,005,437 M59K probably damaging Het
Olfr949-ps1 T C 9: 39,365,479 *307R probably null Het
Pcdh15 A T 10: 74,584,216 K1235N probably damaging Het
Pcif1 A G 2: 164,884,331 K51E probably damaging Het
Pde1b G A 15: 103,521,325 D82N probably damaging Het
Phf23 T A 11: 69,998,641 V167E possibly damaging Het
Pik3c2g T C 6: 139,967,894 V1006A unknown Het
Pkhd1l1 G T 15: 44,589,486 V3936F probably damaging Het
Pnpla1 T C 17: 28,881,185 V342A probably benign Het
Ppip5k1 T C 2: 121,340,848 D620G possibly damaging Het
Ppl A G 16: 5,089,341 L1030P possibly damaging Het
Prelid1 A T 13: 55,321,275 probably benign Het
Racgap1 C T 15: 99,631,200 S264N probably benign Het
Rdh13 T C 7: 4,427,697 D289G probably benign Het
Rtp3 T C 9: 110,986,296 I334V probably benign Het
Setd2 A T 9: 110,562,944 D200V Het
Simc1 A G 13: 54,503,918 S15G unknown Het
Sirpb1c A T 3: 15,833,225 M150K probably benign Het
Smoc1 T A 12: 81,150,701 D202E probably damaging Het
Spata31d1b A G 13: 59,712,490 Y59C probably damaging Het
Stard9 A G 2: 120,698,280 T1673A probably damaging Het
Tbc1d31 T A 15: 57,916,108 H72Q probably benign Het
Tgfbrap1 C A 1: 43,075,533 V136L probably damaging Het
Top2b A G 14: 16,407,376 N720S probably null Het
Vmn1r11 T C 6: 57,138,199 S283P probably damaging Het
Vmn1r19 A G 6: 57,405,095 H211R probably damaging Het
Vmn2r44 A T 7: 8,367,539 M836K probably benign Het
Vmn2r61 A C 7: 42,265,983 H118P probably benign Het
Vps33a A G 5: 123,558,633 I319T probably benign Het
Vwf T A 6: 125,566,257 S151T Het
Zfp423 T C 8: 87,782,243 N491S possibly damaging Het
Zfp626 T C 7: 27,808,235 F23S probably damaging Het
Other mutations in Hmcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Hmcn2 APN 2 31343096 missense probably damaging 1.00
IGL00966:Hmcn2 APN 2 31428994 missense probably damaging 0.97
IGL00973:Hmcn2 APN 2 31383821 intron probably benign
IGL01364:Hmcn2 APN 2 31361814 nonsense probably null
IGL01486:Hmcn2 APN 2 31336621 missense probably damaging 1.00
IGL01530:Hmcn2 APN 2 31354264 missense possibly damaging 0.85
IGL01550:Hmcn2 APN 2 31424252 missense possibly damaging 0.84
IGL01710:Hmcn2 APN 2 31343102 missense probably damaging 1.00
IGL01764:Hmcn2 APN 2 31405630 missense possibly damaging 0.93
IGL01924:Hmcn2 APN 2 31398917 missense probably benign 0.00
IGL02003:Hmcn2 APN 2 31428982 missense possibly damaging 0.90
IGL02117:Hmcn2 APN 2 31457173 missense possibly damaging 0.75
IGL02205:Hmcn2 APN 2 31400127 missense probably damaging 1.00
IGL02273:Hmcn2 APN 2 31424377 missense probably benign 0.06
IGL02313:Hmcn2 APN 2 31453605 missense possibly damaging 0.68
IGL02326:Hmcn2 APN 2 31450952 missense probably damaging 0.97
IGL02486:Hmcn2 APN 2 31420095 missense probably damaging 0.98
IGL02551:Hmcn2 APN 2 31454811 missense possibly damaging 0.83
IGL02695:Hmcn2 APN 2 31408973 missense possibly damaging 0.87
IGL02725:Hmcn2 APN 2 31405528 missense probably damaging 1.00
IGL02792:Hmcn2 APN 2 31346590 missense probably damaging 1.00
IGL02882:Hmcn2 APN 2 31413367 nonsense probably null
IGL03003:Hmcn2 APN 2 31433486 missense probably damaging 0.98
IGL03067:Hmcn2 APN 2 31346630 missense probably damaging 1.00
IGL03137:Hmcn2 APN 2 31362230 missense probably damaging 0.98
IGL03220:Hmcn2 APN 2 31346621 missense possibly damaging 0.94
IGL03411:Hmcn2 APN 2 31346637 missense possibly damaging 0.83
PIT4544001:Hmcn2 UTSW 2 31428250 missense probably damaging 0.98
R0044:Hmcn2 UTSW 2 31412508 missense probably damaging 0.98
R0044:Hmcn2 UTSW 2 31412508 missense probably damaging 0.98
R0048:Hmcn2 UTSW 2 31428237 missense possibly damaging 0.92
R0048:Hmcn2 UTSW 2 31428237 missense possibly damaging 0.92
R0078:Hmcn2 UTSW 2 31388344 missense probably damaging 1.00
R0090:Hmcn2 UTSW 2 31426198 missense probably damaging 1.00
R0173:Hmcn2 UTSW 2 31438331 critical splice donor site probably null
R0257:Hmcn2 UTSW 2 31369164 splice site probably benign
R0266:Hmcn2 UTSW 2 31394827 missense probably benign 0.03
R0266:Hmcn2 UTSW 2 31445353 splice site probably benign
R0326:Hmcn2 UTSW 2 31423225 nonsense probably null
R0366:Hmcn2 UTSW 2 31424206 missense possibly damaging 0.88
R0400:Hmcn2 UTSW 2 31400129 missense probably damaging 0.98
R0412:Hmcn2 UTSW 2 31388247 missense probably damaging 0.98
R0436:Hmcn2 UTSW 2 31405612 missense probably damaging 1.00
R0457:Hmcn2 UTSW 2 31415284 critical splice donor site probably null
R0487:Hmcn2 UTSW 2 31386677 missense possibly damaging 0.60
R0568:Hmcn2 UTSW 2 31415236 missense probably benign 0.02
R0755:Hmcn2 UTSW 2 31453160 missense probably damaging 0.99
R0811:Hmcn2 UTSW 2 31420371 missense probably damaging 0.99
R0812:Hmcn2 UTSW 2 31420371 missense probably damaging 0.99
R0964:Hmcn2 UTSW 2 31391511 missense probably benign 0.23
R0988:Hmcn2 UTSW 2 31335451 missense probably damaging 1.00
R1484:Hmcn2 UTSW 2 31346495 missense probably damaging 1.00
R1509:Hmcn2 UTSW 2 31314479 missense possibly damaging 0.86
R1535:Hmcn2 UTSW 2 31420407 missense possibly damaging 0.91
R1574:Hmcn2 UTSW 2 31404887 missense probably damaging 0.97
R1574:Hmcn2 UTSW 2 31404887 missense probably damaging 0.97
R1600:Hmcn2 UTSW 2 31430787 missense probably damaging 0.98
R1623:Hmcn2 UTSW 2 31458039 missense possibly damaging 0.84
R1692:Hmcn2 UTSW 2 31450844 missense possibly damaging 0.47
R1719:Hmcn2 UTSW 2 31354721 missense probably damaging 1.00
R1747:Hmcn2 UTSW 2 31457985 missense probably benign 0.00
R1756:Hmcn2 UTSW 2 31396120 missense probably damaging 0.99
R1763:Hmcn2 UTSW 2 31314590 missense probably damaging 1.00
R1815:Hmcn2 UTSW 2 31393043 missense probably damaging 0.97
R1822:Hmcn2 UTSW 2 31383692 missense probably damaging 0.99
R1858:Hmcn2 UTSW 2 31415283 critical splice donor site probably null
R1895:Hmcn2 UTSW 2 31405635 missense probably damaging 0.99
R1908:Hmcn2 UTSW 2 31411910 critical splice donor site probably null
R1946:Hmcn2 UTSW 2 31405635 missense probably damaging 0.99
R1966:Hmcn2 UTSW 2 31389329 missense probably damaging 0.99
R2007:Hmcn2 UTSW 2 31438255 missense possibly damaging 0.91
R2050:Hmcn2 UTSW 2 31335436 missense probably damaging 1.00
R2055:Hmcn2 UTSW 2 31378282 missense probably benign 0.33
R2097:Hmcn2 UTSW 2 31380419 missense probably damaging 1.00
R2145:Hmcn2 UTSW 2 31333931 splice site probably benign
R2155:Hmcn2 UTSW 2 31460349 missense possibly damaging 0.68
R2170:Hmcn2 UTSW 2 31380281 missense probably benign 0.08
R2188:Hmcn2 UTSW 2 31419935 missense probably benign 0.14
R2208:Hmcn2 UTSW 2 31380297 missense probably damaging 1.00
R2217:Hmcn2 UTSW 2 31350574 missense probably benign 0.02
R2407:Hmcn2 UTSW 2 31335412 critical splice acceptor site probably null
R2764:Hmcn2 UTSW 2 31388298 missense probably damaging 0.98
R2913:Hmcn2 UTSW 2 31460210 missense possibly damaging 0.68
R2986:Hmcn2 UTSW 2 31360998 missense probably damaging 1.00
R3157:Hmcn2 UTSW 2 31400255 missense probably damaging 0.99
R3406:Hmcn2 UTSW 2 31433272 splice site probably benign
R3429:Hmcn2 UTSW 2 31409144 missense possibly damaging 0.87
R3737:Hmcn2 UTSW 2 31336612 nonsense probably null
R3739:Hmcn2 UTSW 2 31336612 nonsense probably null
R3771:Hmcn2 UTSW 2 31360896 missense probably damaging 0.99
R3772:Hmcn2 UTSW 2 31360896 missense probably damaging 0.99
R3773:Hmcn2 UTSW 2 31360896 missense probably damaging 0.99
R3804:Hmcn2 UTSW 2 31352885 splice site probably null
R3837:Hmcn2 UTSW 2 31413407 missense probably damaging 0.99
R3838:Hmcn2 UTSW 2 31413407 missense probably damaging 0.99
R3846:Hmcn2 UTSW 2 31430350 missense possibly damaging 0.51
R3925:Hmcn2 UTSW 2 31453157 missense probably benign 0.00
R3934:Hmcn2 UTSW 2 31380484 critical splice donor site probably null
R3946:Hmcn2 UTSW 2 31382394 missense possibly damaging 0.91
R4035:Hmcn2 UTSW 2 31336612 nonsense probably null
R4057:Hmcn2 UTSW 2 31400238 missense probably damaging 1.00
R4583:Hmcn2 UTSW 2 31413265 missense possibly damaging 0.84
R4623:Hmcn2 UTSW 2 31396710 missense probably damaging 1.00
R4647:Hmcn2 UTSW 2 31399019 missense possibly damaging 0.82
R4668:Hmcn2 UTSW 2 31435792 missense probably benign 0.40
R4669:Hmcn2 UTSW 2 31435792 missense probably benign 0.40
R4687:Hmcn2 UTSW 2 31438285 missense probably benign 0.14
R4735:Hmcn2 UTSW 2 31383775 missense probably benign 0.06
R4772:Hmcn2 UTSW 2 31445314 missense probably benign 0.02
R4866:Hmcn2 UTSW 2 31389391 missense possibly damaging 0.88
R4916:Hmcn2 UTSW 2 31360980 missense probably damaging 0.98
R4943:Hmcn2 UTSW 2 31335492 missense probably damaging 1.00
R4967:Hmcn2 UTSW 2 31354164 critical splice acceptor site probably null
R4973:Hmcn2 UTSW 2 31344096 missense probably benign 0.15
R4975:Hmcn2 UTSW 2 31393025 missense possibly damaging 0.88
R4994:Hmcn2 UTSW 2 31458055 critical splice donor site probably null
R4997:Hmcn2 UTSW 2 31401708 missense probably damaging 1.00
R5045:Hmcn2 UTSW 2 31409081 missense probably damaging 1.00
R5117:Hmcn2 UTSW 2 31458049 missense possibly damaging 0.95
R5151:Hmcn2 UTSW 2 31389443 missense probably null
R5232:Hmcn2 UTSW 2 31457748 missense probably damaging 0.99
R5237:Hmcn2 UTSW 2 31414716 missense probably benign 0.01
R5288:Hmcn2 UTSW 2 31460321 missense probably benign 0.11
R5375:Hmcn2 UTSW 2 31430441 missense possibly damaging 0.92
R5379:Hmcn2 UTSW 2 31409011 missense probably damaging 0.99
R5385:Hmcn2 UTSW 2 31460321 missense probably benign 0.11
R5412:Hmcn2 UTSW 2 31346617 missense possibly damaging 0.77
R5426:Hmcn2 UTSW 2 31336544 missense possibly damaging 0.95
R5434:Hmcn2 UTSW 2 31420363 missense probably damaging 1.00
R5441:Hmcn2 UTSW 2 31406416 missense possibly damaging 0.82
R5484:Hmcn2 UTSW 2 31393054 nonsense probably null
R5492:Hmcn2 UTSW 2 31420306 missense probably benign 0.03
R5572:Hmcn2 UTSW 2 31414525 critical splice acceptor site probably null
R5572:Hmcn2 UTSW 2 31414526 critical splice acceptor site probably null
R5591:Hmcn2 UTSW 2 31344047 missense probably damaging 1.00
R5614:Hmcn2 UTSW 2 31428303 missense probably damaging 0.99
R5634:Hmcn2 UTSW 2 31333881 missense probably damaging 1.00
R5645:Hmcn2 UTSW 2 31420812 missense possibly damaging 0.92
R5716:Hmcn2 UTSW 2 31336567 missense probably damaging 1.00
R5716:Hmcn2 UTSW 2 31458738 missense possibly damaging 0.68
R5725:Hmcn2 UTSW 2 31383815 critical splice donor site probably null
R5760:Hmcn2 UTSW 2 31414568 missense possibly damaging 0.91
R5774:Hmcn2 UTSW 2 31409135 missense possibly damaging 0.94
R5838:Hmcn2 UTSW 2 31457807 missense probably damaging 0.99
R5899:Hmcn2 UTSW 2 31354673 missense possibly damaging 0.93
R5916:Hmcn2 UTSW 2 31396139 missense probably damaging 1.00
R5973:Hmcn2 UTSW 2 31420323 missense probably damaging 0.99
R6002:Hmcn2 UTSW 2 31420309 missense probably damaging 0.99
R6018:Hmcn2 UTSW 2 31370792 missense probably benign 0.13
R6063:Hmcn2 UTSW 2 31434713 missense probably benign 0.06
R6161:Hmcn2 UTSW 2 31356254 missense probably benign
R6166:Hmcn2 UTSW 2 31369262 missense probably damaging 1.00
R6177:Hmcn2 UTSW 2 31420106 nonsense probably null
R6191:Hmcn2 UTSW 2 31458746 missense probably damaging 0.99
R6195:Hmcn2 UTSW 2 31384115 missense probably damaging 0.96
R6273:Hmcn2 UTSW 2 31411834 missense probably damaging 0.99
R6293:Hmcn2 UTSW 2 31335451 missense probably damaging 1.00
R6349:Hmcn2 UTSW 2 31388373 missense probably damaging 1.00
R6395:Hmcn2 UTSW 2 31369257 missense probably damaging 1.00
R6448:Hmcn2 UTSW 2 31420820 missense probably benign 0.02
R6450:Hmcn2 UTSW 2 31361800 missense probably benign 0.11
R6479:Hmcn2 UTSW 2 31425468 missense probably damaging 0.99
R6502:Hmcn2 UTSW 2 31382478 missense probably damaging 0.99
R6511:Hmcn2 UTSW 2 31356342 missense possibly damaging 0.79
R6537:Hmcn2 UTSW 2 31415268 missense probably benign 0.00
R6880:Hmcn2 UTSW 2 31343056 missense probably damaging 1.00
R6924:Hmcn2 UTSW 2 31350505 splice site probably null
R6971:Hmcn2 UTSW 2 31432321 missense probably benign 0.02
R7057:Hmcn2 UTSW 2 31422649 missense probably damaging 0.99
R7141:Hmcn2 UTSW 2 31360896 missense probably benign 0.17
R7268:Hmcn2 UTSW 2 31457966 missense possibly damaging 0.48
R7307:Hmcn2 UTSW 2 31343081 missense probably damaging 0.96
R7322:Hmcn2 UTSW 2 31459081 missense probably damaging 0.99
R7334:Hmcn2 UTSW 2 31435794 missense probably damaging 0.98
R7334:Hmcn2 UTSW 2 31453135 missense possibly damaging 0.82
R7335:Hmcn2 UTSW 2 31392157 missense possibly damaging 0.88
R7358:Hmcn2 UTSW 2 31416812 missense probably damaging 1.00
R7488:Hmcn2 UTSW 2 31420830 missense probably damaging 1.00
R7498:Hmcn2 UTSW 2 31383475 intron probably null
R7560:Hmcn2 UTSW 2 31457173 missense probably benign
R7566:Hmcn2 UTSW 2 31454857 missense probably damaging 0.96
R7570:Hmcn2 UTSW 2 31423911 missense probably benign
R7574:Hmcn2 UTSW 2 31455519 missense possibly damaging 0.68
R7599:Hmcn2 UTSW 2 31356286 missense possibly damaging 0.93
R7654:Hmcn2 UTSW 2 31346569 missense probably benign 0.00
R7662:Hmcn2 UTSW 2 31382345 missense probably benign 0.01
R7666:Hmcn2 UTSW 2 31380233 missense probably damaging 1.00
R7698:Hmcn2 UTSW 2 31423153 missense probably damaging 0.98
R7722:Hmcn2 UTSW 2 31382500 nonsense probably null
X0066:Hmcn2 UTSW 2 31454811 missense possibly damaging 0.83
X0067:Hmcn2 UTSW 2 31405867 missense possibly damaging 0.82
Z1088:Hmcn2 UTSW 2 31459064 intron probably null
Z1088:Hmcn2 UTSW 2 31381067 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCACCTACCATTGAGGGTG -3'
(R):5'- GCCTCGCTATTCATCTGTGG -3'

Sequencing Primer
(F):5'- ACCTACCATTGAGGGTGCTGAC -3'
(R):5'- TCGCTATTCATCTGTGGCATAC -3'
Posted On2019-09-13