Incidental Mutation 'R7404:Lamb2'
ID574435
Institutional Source Beutler Lab
Gene Symbol Lamb2
Ensembl Gene ENSMUSG00000052911
Gene Namelaminin, beta 2
SynonymsLams, npht, Lamb-2
Accession Numbers

Genbank: NM_008483; MGI: 99916

Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock #R7404 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108479736-108490530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108487583 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1179 (R1179C)
Ref Sequence ENSEMBL: ENSMUSP00000069087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006854] [ENSMUST00000065014] [ENSMUST00000085044] [ENSMUST00000166103] [ENSMUST00000178075] [ENSMUST00000193678]
Predicted Effect probably benign
Transcript: ENSMUST00000006854
SMART Domains Protein: ENSMUSP00000006854
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 1.3e-6 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 7.1e-19 PFAM
Pfam:USP19_linker 415 537 2.2e-61 PFAM
Pfam:UCH 538 1253 1.2e-77 PFAM
Pfam:UCH_1 539 874 8.6e-11 PFAM
Pfam:zf-MYND 833 875 9.9e-11 PFAM
Pfam:UCH_1 1021 1235 7.1e-10 PFAM
low complexity region 1278 1287 N/A INTRINSIC
low complexity region 1301 1312 N/A INTRINSIC
transmembrane domain 1333 1355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000065014
AA Change: R1179C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069087
Gene: ENSMUSG00000052911
AA Change: R1179C

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
LamNT 44 284 1.9e-102 SMART
EGF_Lam 286 347 1.34e-6 SMART
EGF_Lam 350 410 6.1e-10 SMART
EGF_Lam 413 470 2.98e-13 SMART
EGF_Lam 473 522 7.93e-9 SMART
EGF_Lam 525 569 1.01e-10 SMART
EGF_Lam 784 829 3.42e-13 SMART
EGF_Lam 832 875 6.54e-10 SMART
EGF_Lam 878 925 1.34e-6 SMART
EGF_Lam 928 984 4.74e-7 SMART
EGF_Lam 987 1036 1.53e-10 SMART
EGF_Lam 1039 1093 6.29e-12 SMART
EGF_Lam 1096 1141 1.79e-7 SMART
EGF_Lam 1144 1188 6.64e-11 SMART
coiled coil region 1261 1299 N/A INTRINSIC
low complexity region 1445 1458 N/A INTRINSIC
coiled coil region 1473 1527 N/A INTRINSIC
low complexity region 1609 1625 N/A INTRINSIC
SCOP:d1eq1a_ 1632 1786 5e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085044
SMART Domains Protein: ENSMUSP00000082119
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 4.7e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 2.5e-15 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 524 530 N/A INTRINSIC
Pfam:UCH 538 1253 7.4e-84 PFAM
Pfam:UCH_1 539 879 2.3e-13 PFAM
Pfam:zf-MYND 833 875 2.4e-10 PFAM
Pfam:UCH_1 1020 1235 2.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166103
SMART Domains Protein: ENSMUSP00000128573
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 2.6e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 390 3.9e-9 PFAM
low complexity region 425 436 N/A INTRINSIC
low complexity region 500 506 N/A INTRINSIC
Pfam:UCH 514 1229 1.8e-84 PFAM
Pfam:UCH_1 515 855 5.5e-14 PFAM
Pfam:zf-MYND 809 851 1.7e-10 PFAM
Pfam:UCH_1 996 1211 6.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178075
SMART Domains Protein: ENSMUSP00000135930
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 1e-6 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 5.4e-15 PFAM
low complexity region 450 461 N/A INTRINSIC
low complexity region 525 531 N/A INTRINSIC
Pfam:UCH 539 1254 4.9e-84 PFAM
Pfam:UCH_1 540 880 1.4e-13 PFAM
Pfam:zf-MYND 834 876 5.2e-10 PFAM
Pfam:UCH_1 1021 1236 1.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193678
SMART Domains Protein: ENSMUSP00000141738
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 6.8e-7 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 3.6e-15 PFAM
low complexity region 448 459 N/A INTRINSIC
low complexity region 523 529 N/A INTRINSIC
Pfam:UCH 537 1252 3.8e-84 PFAM
Pfam:UCH_1 538 878 1.1e-13 PFAM
Pfam:zf-MYND 832 874 5.1e-10 PFAM
Pfam:UCH_1 1019 1234 1.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype Strain: 2138070
Lethality: D1-D30
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 2. The beta 2 chain contains the 7 structural domains typical of beta chains of laminin, including the short alpha region. However, unlike beta 1 chain, beta 2 has a more restricted tissue distribution. It is enriched in the basement membrane of muscles at the neuromuscular junctions, kidney glomerulus and vascular smooth muscle. Transgenic mice in which the beta 2 chain gene was inactivated by homologous recombination, showed defects in the maturation of neuromuscular junctions and impairment of glomerular filtration. Alternative splicing involving a non consensus 5' splice site (gc) in the 5' UTR of this gene has been reported. It was suggested that inefficient splicing of this first intron, which does not change the protein sequence, results in a greater abundance of the unspliced form of the transcript than the spliced form. The full-length nature of the spliced transcript is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit small size, severe proteinuria due to a defect in glomerular filtration, abnormalities of the retina and skeletal neuromuscular synapses, and lethality by 30 days of age. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
Ablim3 C T 18: 61,822,028 A297T probably damaging Het
Adprhl1 T A 8: 13,225,118 S547C probably damaging Het
Ankrd63 G C 2: 118,703,312 R43G unknown Het
Asah2 T C 19: 32,057,854 T24A probably benign Het
Atp8b5 C T 4: 43,342,640 T437I probably benign Het
Bbs2 T C 8: 94,082,364 D311G probably damaging Het
Birc6 C T 17: 74,639,794 T2851I possibly damaging Het
Cchcr1 T C 17: 35,524,796 W266R probably benign Het
Col14a1 C A 15: 55,388,628 S560* probably null Het
Crocc G A 4: 141,026,186 T1317M possibly damaging Het
Cxxc1 T A 18: 74,219,207 V334E possibly damaging Het
Cyp3a25 T A 5: 145,986,825 D336V probably damaging Het
D430042O09Rik A T 7: 125,865,262 N1267I probably damaging Het
Dapk1 A G 13: 60,719,641 T221A probably benign Het
Dnah11 G T 12: 118,104,808 T1605K probably benign Het
Dnah7c T C 1: 46,666,063 V2412A possibly damaging Het
Ect2l T A 10: 18,159,781 D524V probably damaging Het
Ehbp1l1 T C 19: 5,720,844 E223G possibly damaging Het
Ephb2 A T 4: 136,771,213 M185K probably damaging Het
Fcer1a T C 1: 173,221,516 K243E probably damaging Het
Fcgbp T A 7: 28,101,507 I1326N probably damaging Het
Fgfr1 T C 8: 25,555,550 V45A probably benign Het
Filip1 T A 9: 79,820,098 E413V possibly damaging Het
Frs3 T C 17: 47,702,726 probably null Het
Fstl4 A G 11: 53,134,071 T257A probably benign Het
Gm15922 T C 7: 3,739,345 Y61C probably damaging Het
Golga5 A T 12: 102,484,519 K477M probably damaging Het
Gpr171 A T 3: 59,098,201 I51K probably damaging Het
H1f0 T A 15: 79,028,880 Y53* probably null Het
Hephl1 A G 9: 15,069,751 V795A possibly damaging Het
Hmcn1 A T 1: 150,720,759 D1775E probably benign Het
Hs3st2 A G 7: 121,500,945 D338G possibly damaging Het
Hsd3b6 T A 3: 98,806,218 Y255F probably benign Het
Hspa9 T C 18: 34,943,276 N328D possibly damaging Het
Hvcn1 T A 5: 122,237,685 I100N probably damaging Het
Ifi207 C T 1: 173,728,928 S748N possibly damaging Het
Kcnma1 G T 14: 24,002,834 T180K unknown Het
Kctd16 A G 18: 40,258,773 D138G probably damaging Het
Kifc3 A G 8: 95,103,464 Y605H probably benign Het
Kmt2d T A 15: 98,845,495 Q3928L unknown Het
Layn T A 9: 51,057,370 I358F possibly damaging Het
Lrig1 G A 6: 94,626,471 T232M probably damaging Het
Lrp1 T C 10: 127,582,708 T38A Het
Map3k14 A G 11: 103,239,092 V333A probably benign Het
Med13 T C 11: 86,286,446 D1608G possibly damaging Het
Mrps31 T G 8: 22,421,413 S224A probably benign Het
Msh6 G T 17: 87,975,120 Het
Ncapd3 A G 9: 27,067,019 D838G probably benign Het
Nlrp1a C A 11: 71,097,093 E1184* probably null Het
Nup210 A T 6: 91,073,245 I414N probably benign Het
Olfr1097 A C 2: 86,890,873 L101V probably benign Het
Olfr1346 T C 7: 6,474,164 L18P probably damaging Het
Olfr1484 T A 19: 13,585,388 I28N possibly damaging Het
Olfr187 T C 16: 59,036,240 T166A possibly damaging Het
Olfr378 A T 11: 73,425,593 L130H probably damaging Het
Olfr666 A T 7: 104,892,974 V218E possibly damaging Het
Olfr876 A T 9: 37,803,961 T17S possibly damaging Het
Otud7b G C 3: 96,136,625 probably null Het
Phf11d A C 14: 59,359,493 W86G probably benign Het
Pik3c2b T A 1: 133,090,706 S964T probably damaging Het
Plod3 G A 5: 136,995,047 V687I probably benign Het
Poglut1 T G 16: 38,537,922 Y208S possibly damaging Het
Pou1f1 T A 16: 65,533,863 L253H probably damaging Het
Pou2f1 C T 1: 165,911,386 A166T unknown Het
Rhbdl3 C T 11: 80,346,833 S297L probably damaging Het
Rxra A T 2: 27,741,854 N179I probably damaging Het
Ryr2 C T 13: 11,735,620 E1922K probably damaging Het
Scube1 T C 15: 83,615,010 Y668C probably damaging Het
Sec16b A G 1: 157,531,357 Y120C probably damaging Het
Sec61b G T 4: 47,483,047 K92N probably damaging Het
Slc13a3 T C 2: 165,434,064 N254S possibly damaging Het
Slc17a7 T A 7: 45,172,930 Y397N probably benign Het
Slc25a3 A G 10: 91,117,040 V333A possibly damaging Het
Slc7a8 A T 14: 54,726,826 V390E probably damaging Het
Srgap1 T C 10: 121,785,745 N948D probably benign Het
Tacc2 A T 7: 130,623,336 T584S probably benign Het
Tec A T 5: 72,763,618 D471E probably damaging Het
Tecpr2 C T 12: 110,931,604 A430V probably benign Het
Tmcc2 A T 1: 132,361,021 D309E probably damaging Het
Tmem82 G A 4: 141,617,431 A67V possibly damaging Het
Ttc23l T C 15: 10,551,577 Q21R probably damaging Het
Ttc37 T A 13: 76,148,747 Y1074* probably null Het
Ubl3 A G 5: 148,511,954 F26L probably damaging Het
Upf2 A G 2: 6,040,203 E1088G unknown Het
Usp9y T A Y: 1,341,780 I1362F probably benign Het
Wnk4 T A 11: 101,268,492 probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Zfc3h1 T A 10: 115,415,248 V1248D probably damaging Het
Zfp12 T A 5: 143,240,344 V56D probably damaging Het
Other mutations in Lamb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Lamb2 APN 9 108487733 unclassified probably null
IGL02072:Lamb2 APN 9 108481908 nonsense probably null
IGL02079:Lamb2 APN 9 108482113 missense probably damaging 1.00
IGL02087:Lamb2 APN 9 108487119 missense possibly damaging 0.95
IGL02193:Lamb2 APN 9 108489360 missense probably benign 0.00
IGL02199:Lamb2 APN 9 108480625 missense possibly damaging 0.49
IGL02201:Lamb2 APN 9 108487542 missense probably damaging 1.00
IGL02468:Lamb2 APN 9 108487149 missense probably damaging 1.00
F6893:Lamb2 UTSW 9 108482556 missense probably benign 0.12
R0053:Lamb2 UTSW 9 108486737 nonsense probably null
R0053:Lamb2 UTSW 9 108486737 nonsense probably null
R0122:Lamb2 UTSW 9 108486514 missense probably benign 0.01
R0452:Lamb2 UTSW 9 108486354 unclassified probably benign
R0524:Lamb2 UTSW 9 108484372 missense possibly damaging 0.90
R0605:Lamb2 UTSW 9 108486105 unclassified probably benign
R0737:Lamb2 UTSW 9 108483794 missense probably benign 0.03
R1083:Lamb2 UTSW 9 108483693 missense probably benign
R1159:Lamb2 UTSW 9 108481408 missense probably damaging 1.00
R1283:Lamb2 UTSW 9 108481808 missense possibly damaging 0.46
R1507:Lamb2 UTSW 9 108490382 missense probably damaging 1.00
R1547:Lamb2 UTSW 9 108482625 missense probably benign 0.00
R1576:Lamb2 UTSW 9 108480307 missense probably damaging 0.96
R1647:Lamb2 UTSW 9 108481423 critical splice donor site probably null
R1678:Lamb2 UTSW 9 108483686 critical splice acceptor site probably null
R1740:Lamb2 UTSW 9 108481928 missense probably damaging 1.00
R1803:Lamb2 UTSW 9 108488099 missense probably benign
R1846:Lamb2 UTSW 9 108487387 missense probably benign 0.00
R1863:Lamb2 UTSW 9 108481384 missense probably benign 0.13
R2184:Lamb2 UTSW 9 108480553 missense probably damaging 1.00
R2262:Lamb2 UTSW 9 108480610 missense probably damaging 1.00
R2338:Lamb2 UTSW 9 108482141 missense probably benign 0.20
R2483:Lamb2 UTSW 9 108480559 missense probably damaging 1.00
R4084:Lamb2 UTSW 9 108488018 missense probably benign 0.17
R4164:Lamb2 UTSW 9 108490298 missense probably damaging 1.00
R4295:Lamb2 UTSW 9 108486211 missense probably benign 0.42
R4422:Lamb2 UTSW 9 108483555 missense probably damaging 0.99
R4497:Lamb2 UTSW 9 108486798 missense probably damaging 1.00
R4880:Lamb2 UTSW 9 108484027 unclassified probably null
R4935:Lamb2 UTSW 9 108487501 missense possibly damaging 0.93
R4977:Lamb2 UTSW 9 108487647 missense probably damaging 0.99
R5152:Lamb2 UTSW 9 108487738 missense probably benign
R5499:Lamb2 UTSW 9 108487802 missense possibly damaging 0.50
R5724:Lamb2 UTSW 9 108480751 splice site probably null
R5932:Lamb2 UTSW 9 108480611 missense probably damaging 1.00
R5997:Lamb2 UTSW 9 108480388 missense possibly damaging 0.65
R6052:Lamb2 UTSW 9 108487612 nonsense probably null
R6142:Lamb2 UTSW 9 108485618 nonsense probably null
R6245:Lamb2 UTSW 9 108488199 splice site probably null
R6531:Lamb2 UTSW 9 108483726 missense possibly damaging 0.78
R6557:Lamb2 UTSW 9 108488400 missense probably damaging 1.00
R6562:Lamb2 UTSW 9 108487008 missense possibly damaging 0.56
R6997:Lamb2 UTSW 9 108481297 missense probably damaging 1.00
R7024:Lamb2 UTSW 9 108489488 missense probably benign 0.00
R7116:Lamb2 UTSW 9 108487323 missense probably damaging 1.00
R7146:Lamb2 UTSW 9 108484084 missense possibly damaging 0.94
R7261:Lamb2 UTSW 9 108481297 missense probably damaging 1.00
R7288:Lamb2 UTSW 9 108488324 missense probably benign 0.20
R7456:Lamb2 UTSW 9 108485780 missense possibly damaging 0.95
R7472:Lamb2 UTSW 9 108486148 missense probably benign 0.01
R7623:Lamb2 UTSW 9 108489224 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CGTGGTGAGAAATCTGGACTGAC -3'
(R):5'- CACTCATAATGGCCTGCACC -3'

Sequencing Primer
(F):5'- CAGGGTAGATAAAGACAATCTCGTC -3'
(R):5'- TAGCTTCCCCTGCATGTTCAAAAAG -3'
Posted On2019-09-13