Incidental Mutation 'R7417:Sdr42e1'
ID575390
Institutional Source Beutler Lab
Gene Symbol Sdr42e1
Ensembl Gene ENSMUSG00000034308
Gene Nameshort chain dehydrogenase/reductase family 42E, member 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7417 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location117661399-117673689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117662751 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 384 (T384A)
Ref Sequence ENSEMBL: ENSMUSP00000044457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037955] [ENSMUST00000173522] [ENSMUST00000174450]
Predicted Effect probably benign
Transcript: ENSMUST00000037955
AA Change: T384A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000044457
Gene: ENSMUSG00000034308
AA Change: T384A

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 9 241 4.2e-14 PFAM
Pfam:Polysacc_synt_2 11 129 7.1e-11 PFAM
Pfam:NAD_binding_10 11 239 3.3e-10 PFAM
Pfam:Epimerase 11 255 6.7e-29 PFAM
Pfam:3Beta_HSD 12 285 3.1e-69 PFAM
Pfam:NAD_binding_4 27 233 7.1e-14 PFAM
transmembrane domain 367 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173522
AA Change: T384A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000133782
Gene: ENSMUSG00000034308
AA Change: T384A

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 9 208 2.4e-13 PFAM
Pfam:Polysacc_synt_2 11 129 5.2e-11 PFAM
Pfam:Epimerase 11 250 4.3e-28 PFAM
Pfam:GDP_Man_Dehyd 12 273 1.3e-9 PFAM
Pfam:3Beta_HSD 12 285 4.7e-69 PFAM
Pfam:NAD_binding_4 27 233 2.1e-11 PFAM
transmembrane domain 367 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174450
SMART Domains Protein: ENSMUSP00000133837
Gene: ENSMUSG00000034308

DomainStartEndE-ValueType
Pfam:adh_short 9 136 1.1e-6 PFAM
Pfam:RmlD_sub_bind 9 184 6.7e-15 PFAM
Pfam:Polysacc_synt_2 11 129 6e-12 PFAM
Pfam:Epimerase 11 176 1.8e-21 PFAM
Pfam:NAD_binding_10 11 189 4.8e-10 PFAM
Pfam:3Beta_HSD 12 189 5.4e-43 PFAM
Pfam:NAD_binding_4 25 186 6.6e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik G A 17: 48,152,889 T213I probably damaging Het
Akr1b7 G A 6: 34,417,365 probably null Het
Aldh6a1 T C 12: 84,441,782 Q110R probably benign Het
Alg11 A T 8: 22,062,028 T63S probably benign Het
Ankrd13b A G 11: 77,476,194 Y271H probably damaging Het
Ano8 T A 8: 71,480,833 D605V unknown Het
Best2 C T 8: 85,009,666 probably null Het
Brca1 A G 11: 101,524,981 S776P probably damaging Het
Capn7 T C 14: 31,370,706 Y737H probably damaging Het
Cblc A T 7: 19,788,974 S333T probably benign Het
Ccm2 T A 11: 6,593,091 M257K probably benign Het
Cd320 T A 17: 33,847,556 C103* probably null Het
Cd53 A G 3: 106,768,919 F44S probably benign Het
Col9a2 G A 4: 121,054,292 R610H not run Het
Cubn T C 2: 13,426,967 I1272V probably benign Het
Cyp2j7 C T 4: 96,201,988 probably null Het
Dmrt2 A T 19: 25,678,598 R520S probably benign Het
Drg2 A G 11: 60,454,680 M1V probably null Het
Ect2 A G 3: 27,098,419 S908P probably damaging Het
Eipr1 A G 12: 28,866,955 T341A probably benign Het
Ell3 A C 2: 121,440,410 I214R probably benign Het
Emsy A T 7: 98,615,486 L568Q probably damaging Het
Foxd4 T C 19: 24,900,462 T125A probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Gcsam C A 16: 45,619,877 H94Q probably damaging Het
Ginm1 T A 10: 7,774,080 I150F probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hk2 G A 6: 82,743,345 A205V probably damaging Het
Il3ra A T 14: 14,349,345 H147L probably benign Het
Map3k6 T A 4: 133,248,396 S732T probably benign Het
Masp2 A G 4: 148,605,721 E229G probably benign Het
Mccc2 A G 13: 99,971,777 probably null Het
Mia3 A G 1: 183,327,653 V359A Het
Mob1a A T 6: 83,332,510 T80S probably benign Het
Msantd2 G A 9: 37,523,294 G478S probably damaging Het
Mtf1 A G 4: 124,825,181 E329G probably null Het
Myh9 T A 15: 77,763,865 K1804* probably null Het
Ndst3 A G 3: 123,671,664 W220R probably damaging Het
Nln A G 13: 104,036,970 L576P probably damaging Het
Nlrc4 A G 17: 74,446,488 M300T probably benign Het
Obscn G T 11: 59,129,577 D880E possibly damaging Het
Olfr1313 A C 2: 112,072,100 V161G probably benign Het
Olfr136 T A 17: 38,335,292 I45N probably damaging Het
Oprd1 T C 4: 132,117,452 T82A probably damaging Het
Orc3 A G 4: 34,595,136 C278R probably damaging Het
Pde4d T A 13: 109,632,788 probably null Het
Pms1 T C 1: 53,197,072 E683G probably benign Het
Prdm2 A T 4: 143,179,299 Y73N probably damaging Het
Prkaa2 T C 4: 105,075,543 Q36R probably benign Het
Psg22 A G 7: 18,722,966 E258G probably damaging Het
Ptprf T C 4: 118,212,172 D1566G probably damaging Het
Rfwd3 T A 8: 111,273,069 Y759F probably benign Het
Ripor2 A G 13: 24,696,550 D411G probably damaging Het
Ryr2 A C 13: 11,556,748 probably null Het
Sec1 A T 7: 45,684,725 probably null Het
Sec16a A T 2: 26,421,397 F616I Het
Sipa1l2 T C 8: 125,482,106 D521G possibly damaging Het
Smc1b T A 15: 85,097,542 Q759L probably benign Het
Snph A T 2: 151,600,343 S57R probably damaging Het
Sqor A T 2: 122,787,530 T103S probably benign Het
Srbd1 A G 17: 86,136,321 V159A probably benign Het
Srsf2 A T 11: 116,852,901 V10E probably damaging Het
Swap70 T A 7: 110,264,109 probably null Het
Synm A C 7: 67,733,206 *675G probably null Het
Tek A G 4: 94,811,345 E320G probably benign Het
Tenm3 T C 8: 48,236,183 D2123G probably damaging Het
Tmod4 A G 3: 95,125,863 K56R possibly damaging Het
Top3b G A 16: 16,877,850 probably benign Het
Tssc4 G T 7: 143,070,688 E244D possibly damaging Het
Twnk G A 19: 45,010,564 probably null Het
Ube4a A C 9: 44,956,713 I45S probably benign Het
Unc79 A T 12: 103,088,758 M954L possibly damaging Het
Vcpip1 A T 1: 9,746,315 D614E probably benign Het
Vmn1r45 T A 6: 89,933,053 I312L probably benign Het
Vmn1r77 A G 7: 12,041,684 Y129C probably damaging Het
Wdr63 A T 3: 146,093,080 probably null Het
Zer1 A G 2: 30,102,822 L600P probably damaging Het
Zfp266 T C 9: 20,500,936 T114A probably benign Het
Zrsr1 T C 11: 22,974,662 probably null Het
Other mutations in Sdr42e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Sdr42e1 APN 8 117663443 missense probably damaging 1.00
IGL01613:Sdr42e1 APN 8 117662937 missense probably benign 0.14
PIT4581001:Sdr42e1 UTSW 8 117663518 missense probably damaging 0.99
R0194:Sdr42e1 UTSW 8 117663109 missense probably damaging 1.00
R1055:Sdr42e1 UTSW 8 117663584 missense probably damaging 0.98
R2108:Sdr42e1 UTSW 8 117665024 missense probably damaging 0.99
R2176:Sdr42e1 UTSW 8 117662877 missense possibly damaging 0.63
R2907:Sdr42e1 UTSW 8 117662772 missense probably damaging 0.99
R4551:Sdr42e1 UTSW 8 117663608 missense probably benign 0.01
R4651:Sdr42e1 UTSW 8 117663621 missense probably benign 0.01
R5148:Sdr42e1 UTSW 8 117663603 missense probably damaging 1.00
R5240:Sdr42e1 UTSW 8 117663282 missense probably benign 0.00
R6242:Sdr42e1 UTSW 8 117663197 missense possibly damaging 0.87
R7716:Sdr42e1 UTSW 8 117673647 start gained probably benign
R7995:Sdr42e1 UTSW 8 117663268 missense probably benign 0.00
R8255:Sdr42e1 UTSW 8 117663763 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGGAGGTCTCAGGAGTCTC -3'
(R):5'- GCGTCACACATTACTTCAGC -3'

Sequencing Primer
(F):5'- CCCTGGCCATGAAGTTTAAAG -3'
(R):5'- GCGTCACACATTACTTCAGCTTAGAG -3'
Posted On2019-10-07