Incidental Mutation 'R7419:Csf2ra'
ID575582
Institutional Source Beutler Lab
Gene Symbol Csf2ra
Ensembl Gene ENSMUSG00000059326
Gene Namecolony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
SynonymsCsfgmra, CD116, GM-CSFRalpha, GM-CSF-Ra
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R7419 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location61224402-61228418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61227053 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 76 (A76T)
Ref Sequence ENSEMBL: ENSMUSP00000075423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076046]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076046
AA Change: A76T

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075423
Gene: ENSMUSG00000059326
AA Change: A76T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:IL6Ra-bind 129 223 5.2e-23 PFAM
FN3 226 311 9.19e-1 SMART
transmembrane domain 326 348 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha subunit of the heterodimeric receptor for colony stimulating factor 2, a cytokine which controls the production, differentiation, and function of granulocytes and macrophages. The encoded protein is a member of the cytokine family of receptors. This gene is found in the pseudoautosomal region (PAR) of the X and Y chromosomes. Multiple transcript variants encoding different isoforms have been found for this gene, with some of the isoforms being membrane-bound and others being soluble. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,276,959 S572P probably damaging Het
Abca13 T C 11: 9,297,833 Y2527H probably damaging Het
Abcc5 A G 16: 20,422,423 I4T possibly damaging Het
Adamts12 C T 15: 11,317,279 T1355I probably benign Het
Aloxe3 A G 11: 69,127,527 T117A probably benign Het
Asb15 A G 6: 24,556,556 I17V probably benign Het
Atf2 A G 2: 73,842,433 V194A probably benign Het
Capn7 T C 14: 31,349,822 V221A probably benign Het
Ccdc107 A T 4: 43,493,512 S28C probably benign Het
Cct4 C T 11: 22,996,420 T162I probably benign Het
Cdc40 A T 10: 40,841,443 H417Q probably damaging Het
Celf1 A G 2: 91,003,243 I115V probably benign Het
Ces3a A G 8: 105,056,424 Y395C probably damaging Het
Cfh C A 1: 140,105,466 C798F probably damaging Het
Clstn3 T C 6: 124,458,129 T313A probably benign Het
Crmp1 T A 5: 37,278,885 M329K probably benign Het
Cspg4 T A 9: 56,888,443 V1154E possibly damaging Het
Cyp2a4 A T 7: 26,314,763 N455I probably benign Het
Cyp4a32 T G 4: 115,611,037 M268R probably benign Het
Dcaf13 T A 15: 39,130,220 I236N probably damaging Het
Dennd2a A G 6: 39,523,463 I56T probably damaging Het
Eif2d T A 1: 131,171,056 S530R probably benign Het
Ep300 T A 15: 81,648,514 M1651K unknown Het
Epha3 G A 16: 63,598,294 T596I probably damaging Het
Fam171a2 C T 11: 102,438,802 C377Y possibly damaging Het
Fat4 T A 3: 39,000,236 N4142K probably damaging Het
Galnt5 C A 2: 58,014,925 S500Y probably damaging Het
Gas6 A G 8: 13,471,456 V431A probably benign Het
Gm21818 A G 13: 120,173,458 E92G probably damaging Het
Gm7544 C T 1: 82,955,781 C56Y unknown Het
Golgb1 T A 16: 36,912,919 L884I possibly damaging Het
Gpatch2l T G 12: 86,265,251 probably null Het
Gpr33 T C 12: 52,023,267 T330A probably benign Het
H2bfm G A X: 136,927,722 R120K unknown Het
Ifi205 A G 1: 174,028,308 M52T possibly damaging Het
Ino80 A T 2: 119,380,014 D1346E probably benign Het
Ino80c T C 18: 24,108,779 K183R unknown Het
Itgal G T 7: 127,306,875 R379L probably benign Het
Itih3 T A 14: 30,914,773 T582S probably benign Het
Kcnb2 T C 1: 15,711,027 S708P possibly damaging Het
Kcnt1 A T 2: 25,915,999 Y1200F probably benign Het
L3mbtl4 G A 17: 68,641,542 D473N probably benign Het
Lama1 T G 17: 67,717,174 I89R Het
Lama2 A G 10: 27,266,634 I616T probably benign Het
Lipm A C 19: 34,116,481 D266A probably benign Het
Lrrc4c A T 2: 97,629,761 H244L probably benign Het
Lrrtm3 T C 10: 64,088,146 E414G probably damaging Het
Ltbp4 A G 7: 27,329,767 V231A unknown Het
Me3 G T 7: 89,736,719 R92L probably damaging Het
Mroh7 T G 4: 106,683,918 I1175L probably benign Het
Muc16 A G 9: 18,641,962 M4345T probably benign Het
Mug2 A G 6: 122,040,570 Y422C possibly damaging Het
N6amt1 T G 16: 87,367,566 S214A possibly damaging Het
Ogfrl1 G A 1: 23,382,982 Q24* probably null Het
Olfr1047 C T 2: 86,228,213 G253R probably damaging Het
Olfr1150-ps1 A T 2: 87,847,062 T264S probably benign Het
Olfr1274-ps A G 2: 90,401,459 D266G probably damaging Het
Olfr1306 G A 2: 111,912,090 P280L probably damaging Het
Olfr1378 T A 11: 50,969,325 Y102* probably null Het
Olfr701 T C 7: 106,818,344 L87P possibly damaging Het
Olfr711 A G 7: 106,972,146 M66T probably benign Het
Olfr731 A C 14: 50,237,991 V298G possibly damaging Het
Olfr839-ps1 A C 9: 19,175,346 M110R possibly damaging Het
Olfr937 T A 9: 39,060,169 I166L probably benign Het
Oser1 A T 2: 163,411,444 D48E probably benign Het
Piwil4 G A 9: 14,702,395 P867L probably damaging Het
Plxna1 A G 6: 89,357,602 L15P unknown Het
Ppan C T 9: 20,891,844 T404I probably benign Het
Pros1 C A 16: 62,928,070 Y635* probably null Het
Rabep2 G A 7: 126,444,170 R414Q probably benign Het
Rbms3 T A 9: 116,822,826 E201V probably damaging Het
Robo4 A C 9: 37,402,809 I119L probably benign Het
S100b A T 10: 76,259,986 D66V probably damaging Het
Serpina1f A G 12: 103,689,842 S376P probably damaging Het
Slc24a4 T C 12: 102,227,091 probably null Het
Slc30a6 T C 17: 74,423,429 V438A probably benign Het
Sobp A G 10: 43,021,808 S594P probably benign Het
Tmem45b T C 9: 31,428,038 D213G probably benign Het
Topbp1 T A 9: 103,323,344 D525E probably benign Het
Trim30c G T 7: 104,388,265 L165I probably benign Het
Unc13b A T 4: 43,174,023 D1617V unknown Het
Ush1c A G 7: 46,229,255 L112P probably damaging Het
Vipr1 T A 9: 121,661,473 I195N probably damaging Het
Vmn2r38 A C 7: 9,075,355 V676G probably damaging Het
Vmn2r87 A T 10: 130,472,123 Y749N probably damaging Het
Vps13d A T 4: 145,115,503 S2615R Het
Whrn A G 4: 63,416,093 V828A possibly damaging Het
Zbp1 A G 2: 173,209,165 V304A probably benign Het
Zeb2 A T 2: 44,996,347 N899K probably benign Het
Zfp148 T C 16: 33,497,141 S728P possibly damaging Het
Zfp518a T A 19: 40,913,763 I712N possibly damaging Het
Zfp683 T C 4: 134,058,900 V446A probably benign Het
Zranb3 A T 1: 127,963,851 V796D possibly damaging Het
Other mutations in Csf2ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Csf2ra APN 19 61226833 missense possibly damaging 0.87
IGL01465:Csf2ra APN 19 61225998 missense possibly damaging 0.95
IGL01693:Csf2ra APN 19 61225996 missense possibly damaging 0.57
IGL02474:Csf2ra APN 19 61226537 missense possibly damaging 0.95
IGL02950:Csf2ra APN 19 61227169 missense probably benign 0.01
R0054:Csf2ra UTSW 19 61226597 missense probably damaging 1.00
R0201:Csf2ra UTSW 19 61225568 missense probably benign 0.14
R0452:Csf2ra UTSW 19 61226895 missense probably benign 0.02
R1735:Csf2ra UTSW 19 61226344 missense probably damaging 0.99
R2016:Csf2ra UTSW 19 61226893 missense probably benign 0.01
R2157:Csf2ra UTSW 19 61227071 missense probably benign 0.05
R3149:Csf2ra UTSW 19 61227320 missense possibly damaging 0.83
R3150:Csf2ra UTSW 19 61227320 missense possibly damaging 0.83
R4747:Csf2ra UTSW 19 61226053 nonsense probably null
R4825:Csf2ra UTSW 19 61226552 missense probably benign 0.10
R5580:Csf2ra UTSW 19 61226217 missense probably damaging 1.00
R5831:Csf2ra UTSW 19 61225212 missense probably damaging 1.00
R5887:Csf2ra UTSW 19 61227328 missense possibly damaging 0.92
R7105:Csf2ra UTSW 19 61225020 missense possibly damaging 0.61
R7123:Csf2ra UTSW 19 61226862 missense probably damaging 1.00
R7721:Csf2ra UTSW 19 61226586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACATCCAGCGTGACAC -3'
(R):5'- TGACGTCATCACATGCCATG -3'

Sequencing Primer
(F):5'- ATCCAGCGTGACACCGTGG -3'
(R):5'- TACTGCTTCCGGGAACTCAG -3'
Posted On2019-10-07