Incidental Mutation 'R7475:Nnmt'
ID579428
Institutional Source Beutler Lab
Gene Symbol Nnmt
Ensembl Gene ENSMUSG00000032271
Gene Namenicotinamide N-methyltransferase
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7475 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location48591877-48605153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48592232 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 165 (C165S)
Ref Sequence ENSEMBL: ENSMUSP00000034808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034808] [ENSMUST00000119426]
PDB Structure
Mouse Nicotinamide N-methyltransferase [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034808
AA Change: C165S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034808
Gene: ENSMUSG00000032271
AA Change: C165S

DomainStartEndE-ValueType
Pfam:NNMT_PNMT_TEMT 1 259 7.4e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119426
SMART Domains Protein: ENSMUSP00000112381
Gene: ENSMUSG00000032271

DomainStartEndE-ValueType
Pfam:NNMT_PNMT_TEMT 1 140 2.9e-59 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methylation is one method by which drug and other xenobiotic compounds are metabolized by the liver. This gene encodes the protein responsible for this enzymatic activity which uses S-adenosyl methionine as the methyl donor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,399,989 N214K probably benign Het
Abcf1 A G 17: 35,963,567 probably null Het
Agxt2 A T 15: 10,409,537 M508L probably benign Het
Akr1c21 A T 13: 4,576,319 Y114F probably benign Het
Amz1 T C 5: 140,744,186 probably null Het
Ank1 G T 8: 23,132,630 A1732S probably benign Het
Atg16l1 T C 1: 87,760,083 S50P possibly damaging Het
AW551984 A G 9: 39,597,940 S302P probably damaging Het
Dedd C A 1: 171,340,313 P185Q probably benign Het
Fam186a A T 15: 99,947,514 V283E unknown Het
Fat2 C A 11: 55,303,653 V1187F probably benign Het
Fbxw11 T C 11: 32,711,999 probably null Het
Fcgbp C T 7: 28,102,976 T1443I probably damaging Het
Foxj2 A G 6: 122,837,842 D279G probably benign Het
Gbp5 A G 3: 142,501,361 D97G probably damaging Het
Gm49368 A T 7: 128,107,982 T661S possibly damaging Het
Gria4 T G 9: 4,513,330 T260P probably damaging Het
Gtf2ird2 T A 5: 134,201,426 D195E possibly damaging Het
Ikzf5 A T 7: 131,392,059 C280S probably benign Het
Ints9 G T 14: 65,026,465 E395D probably null Het
Isoc2b T C 7: 4,851,085 D96G probably benign Het
Jmjd1c T G 10: 67,225,313 S967R probably benign Het
Kcnj3 A T 2: 55,437,326 K42N probably benign Het
Kiz T C 2: 146,891,086 V394A possibly damaging Het
Knl1 A T 2: 119,087,546 H1795L probably damaging Het
Lmntd2 A G 7: 141,210,689 probably null Het
Loxhd1 C A 18: 77,412,305 D1690E possibly damaging Het
Lrp1b T C 2: 41,344,576 D1121G Het
Map3k2 T C 18: 32,199,962 V63A possibly damaging Het
Mcc G T 18: 44,476,236 A499D probably damaging Het
Mcpt9 T A 14: 56,026,943 I232F probably damaging Het
Meltf A G 16: 31,881,938 K92R probably benign Het
Mrgpra3 T A 7: 47,589,947 Y77F probably damaging Het
Ndufv2 A G 17: 66,087,537 V111A possibly damaging Het
Nkd2 T C 13: 73,825,742 E99G probably damaging Het
Nlk C A 11: 78,583,399 G358V probably damaging Het
Nxpe4 T A 9: 48,393,340 C242* probably null Het
Oas1b A T 5: 120,817,640 N162I probably damaging Het
Olfr1191-ps1 A G 2: 88,643,210 I148V probably benign Het
Otog A G 7: 46,267,276 N879S probably damaging Het
Park2 A G 17: 11,434,614 D199G probably benign Het
Pcsk7 T A 9: 45,927,625 Y612N probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pkhd1l1 C T 15: 44,505,185 Q800* probably null Het
Pkn3 T C 2: 30,087,110 S621P probably benign Het
Polr3c T C 3: 96,715,185 I385V probably benign Het
Ppp1r21 G T 17: 88,555,603 G257W probably benign Het
Pxylp1 C T 9: 96,856,367 probably null Het
Rasgrp1 T C 2: 117,286,108 T613A probably benign Het
Robo3 C T 9: 37,425,378 V387I probably benign Het
Rxfp2 T A 5: 150,049,581 Y174N possibly damaging Het
Sec24a T C 11: 51,713,552 M746V probably damaging Het
Sema4f T A 6: 82,914,374 E571D possibly damaging Het
Sept3 T C 15: 82,286,456 V217A probably benign Het
Serpinb1b A C 13: 33,093,565 K260N probably benign Het
Sin3b A G 8: 72,749,872 T645A possibly damaging Het
Sobp C T 10: 43,021,834 R585Q probably damaging Het
Specc1l T A 10: 75,246,447 L559Q possibly damaging Het
Srxn1 C T 2: 152,105,653 probably benign Het
Sspo G A 6: 48,455,860 R890Q probably benign Het
Stard9 A G 2: 120,688,110 D505G probably damaging Het
Tjp1 A T 7: 65,322,339 I653K probably damaging Het
Tnks C T 8: 34,831,712 E1296K probably damaging Het
Ttbk2 A T 2: 120,748,640 I667N probably benign Het
Usp24 T C 4: 106,342,353 S165P possibly damaging Het
Usp46 T A 5: 74,028,937 K109* probably null Het
Vmn1r191 A G 13: 22,178,772 C271R probably benign Het
Wisp3 T A 10: 39,158,300 Y102F probably damaging Het
Zfp592 T C 7: 81,023,452 S55P probably damaging Het
Zmynd15 T C 11: 70,461,041 S158P probably benign Het
Zscan22 T G 7: 12,906,737 C303G probably damaging Het
Other mutations in Nnmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Nnmt APN 9 48591924 utr 3 prime probably benign
IGL02010:Nnmt APN 9 48592031 missense probably damaging 0.99
IGL02399:Nnmt APN 9 48603538 missense probably damaging 1.00
IGL02593:Nnmt APN 9 48604803 critical splice donor site probably null
IGL03155:Nnmt APN 9 48592052 missense probably damaging 1.00
R0243:Nnmt UTSW 9 48592138 missense probably benign 0.01
R0580:Nnmt UTSW 9 48592300 missense probably damaging 1.00
R1661:Nnmt UTSW 9 48604874 missense probably benign 0.01
R5572:Nnmt UTSW 9 48592147 missense probably damaging 1.00
R5692:Nnmt UTSW 9 48603480 missense probably benign
R6599:Nnmt UTSW 9 48603369 missense probably benign 0.29
R7785:Nnmt UTSW 9 48592009 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATGGTGTAACCGGCCTCTTC -3'
(R):5'- GAACAAAGAAATCTGGGGTCTCCG -3'

Sequencing Primer
(F):5'- GTAACCGGCCTCTTCCACAG -3'
(R):5'- TCTCCGTATCTAGAGCAGCAAGTG -3'
Posted On2019-10-07