Incidental Mutation 'R7539:Prlr'
ID 583810
Institutional Source Beutler Lab
Gene Symbol Prlr
Ensembl Gene ENSMUSG00000005268
Gene Name prolactin receptor
Synonyms Prlr-rs1, Pr-1
MMRRC Submission 045611-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.303) question?
Stock # R7539 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 10177324-10349266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 10329109 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 528 (T528I)
Ref Sequence ENSEMBL: ENSMUSP00000122219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124470] [ENSMUST00000128450] [ENSMUST00000128921] [ENSMUST00000137867] [ENSMUST00000148257]
AlphaFold Q08501
Predicted Effect probably benign
Transcript: ENSMUST00000124470
AA Change: T528I

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122219
Gene: ENSMUSG00000005268
AA Change: T528I

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 278 291 N/A INTRINSIC
low complexity region 342 356 N/A INTRINSIC
low complexity region 384 397 N/A INTRINSIC
low complexity region 454 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128450
SMART Domains Protein: ENSMUSP00000122209
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128921
SMART Domains Protein: ENSMUSP00000121280
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137867
SMART Domains Protein: ENSMUSP00000121935
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148257
SMART Domains Protein: ENSMUSP00000118355
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157020
SMART Domains Protein: ENSMUSP00000120297
Gene: ENSMUSG00000094814

DomainStartEndE-ValueType
transmembrane domain 20 41 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for the anterior pituitary hormone, prolactin, and belongs to the type I cytokine receptor family. Prolactin-dependent signaling occurs as the result of ligand-induced dimerization of the prolactin receptor. Several alternatively spliced transcript variants encoding different membrane-bound and soluble isoforms have been described for this gene, which may function to modulate the endocrine and autocrine effects of prolactin in normal tissue and cancer. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal growth, hormone and glucose homeostasis, hair cycling, female reproductive behavior, morphology, and function, and thyroid, prostate, Hardarian, and lacrimal gland morphologies. Heterozygous mice exhibit defective neuron proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 103,708,470 (GRCm39) E113G probably damaging Het
Abcf3 T C 16: 20,371,382 (GRCm39) probably null Het
Agbl1 T C 7: 76,075,677 (GRCm39) probably null Het
Ap5m1 C A 14: 49,311,014 (GRCm39) P28Q probably damaging Het
Bet1l T C 7: 140,434,457 (GRCm39) D83G probably benign Het
Birc6 T C 17: 74,956,691 (GRCm39) S3571P probably damaging Het
Bod1l A T 5: 41,975,203 (GRCm39) M2037K possibly damaging Het
Ccdc80 A T 16: 44,915,445 (GRCm39) E67V probably benign Het
Cep112 A G 11: 108,746,654 (GRCm39) M133V probably benign Het
Ckmt2 C A 13: 92,008,063 (GRCm39) D224Y probably damaging Het
Cplane1 A G 15: 8,230,728 (GRCm39) I1002V probably benign Het
Crb1 T G 1: 139,175,967 (GRCm39) K672T probably damaging Het
Dnhd1 T C 7: 105,370,119 (GRCm39) S4515P probably damaging Het
Dock9 A G 14: 121,818,848 (GRCm39) S1545P probably damaging Het
Dop1a T G 9: 86,403,626 (GRCm39) S145A probably benign Het
Eps8l1 T C 7: 4,473,036 (GRCm39) S92P probably damaging Het
Faap100 T C 11: 120,268,464 (GRCm39) D103G possibly damaging Het
Fech T A 18: 64,616,565 (GRCm39) probably null Het
Folh1 T A 7: 86,375,117 (GRCm39) E623V probably benign Het
Galnt5 T C 2: 57,925,242 (GRCm39) L841P probably damaging Het
Ggh C G 4: 20,049,833 (GRCm39) S88C probably damaging Het
Gm10577 C T 4: 100,877,893 (GRCm39) V1I unknown Het
Grip1 T A 10: 119,890,776 (GRCm39) H938Q probably benign Het
Gucy2g G A 19: 55,191,586 (GRCm39) A955V probably damaging Het
Hpd G C 5: 123,316,255 (GRCm39) Y165* probably null Het
Iqsec1 C A 6: 90,639,873 (GRCm39) R955L probably benign Het
Masp1 A T 16: 23,289,128 (GRCm39) H557Q possibly damaging Het
Muc4 C T 16: 32,576,770 (GRCm39) T20M Het
Myo16 T C 8: 10,411,095 (GRCm39) probably null Het
Nfkb2 T C 19: 46,296,662 (GRCm39) F273L possibly damaging Het
Nherf2 G T 17: 24,860,873 (GRCm39) A223D probably damaging Het
Or11l3 A T 11: 58,516,782 (GRCm39) I29N probably damaging Het
Or1l8 T C 2: 36,817,221 (GRCm39) R302G probably benign Het
Or2a56 T C 6: 42,933,037 (GRCm39) C202R possibly damaging Het
Or4k49 T C 2: 111,494,778 (GRCm39) V69A possibly damaging Het
Or52ab7 A G 7: 102,977,701 (GRCm39) S3G probably benign Het
Or52e3 T C 7: 102,869,273 (GRCm39) V116A possibly damaging Het
Or5b124 C T 19: 13,610,933 (GRCm39) Q153* probably null Het
Or6c2 A T 10: 129,362,974 (GRCm39) K293* probably null Het
Or6c69 T C 10: 129,747,932 (GRCm39) T72A probably damaging Het
Or7e174 A T 9: 20,012,915 (GRCm39) M287L probably benign Het
Parp4 T A 14: 56,873,212 (GRCm39) I1152N probably damaging Het
Peg3 T C 7: 6,711,167 (GRCm39) T1352A probably benign Het
Pik3c2a T C 7: 115,939,331 (GRCm39) N1669S probably damaging Het
Pinx1 A T 14: 64,156,655 (GRCm39) Q194L probably benign Het
Podxl2 A C 6: 88,826,311 (GRCm39) S268A probably benign Het
Polr2c C A 8: 95,597,407 (GRCm39) H363N unknown Het
Rab37 A C 11: 115,051,487 (GRCm39) Q198P probably benign Het
Rrm2b T A 15: 37,937,595 (GRCm39) probably null Het
Serpina3b T C 12: 104,096,970 (GRCm39) S84P possibly damaging Het
Stat4 A T 1: 52,110,868 (GRCm39) probably null Het
Them6 T C 15: 74,595,349 (GRCm39) I185T probably damaging Het
Tmco4 T A 4: 138,749,010 (GRCm39) M316K probably benign Het
Tmtc4 G T 14: 123,215,701 (GRCm39) probably null Het
Tnni3k A T 3: 154,667,668 (GRCm39) N248K probably benign Het
Trim43a T A 9: 88,465,096 (GRCm39) L141Q probably benign Het
Utp20 C T 10: 88,627,607 (GRCm39) V953M probably damaging Het
Vmn2r118 T A 17: 55,899,853 (GRCm39) T684S probably damaging Het
Wasl A T 6: 24,619,197 (GRCm39) I441N unknown Het
Wfikkn2 T C 11: 94,133,185 (GRCm39) D64G probably damaging Het
Zfp128 C A 7: 12,624,479 (GRCm39) Y282* probably null Het
Other mutations in Prlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Prlr APN 15 10,328,410 (GRCm39) missense probably benign 0.00
IGL00688:Prlr APN 15 10,322,467 (GRCm39) unclassified probably benign
IGL01527:Prlr APN 15 10,329,257 (GRCm39) missense probably benign 0.28
IGL01626:Prlr APN 15 10,328,804 (GRCm39) missense probably benign 0.12
IGL01660:Prlr APN 15 10,317,676 (GRCm39) missense probably damaging 1.00
IGL01835:Prlr APN 15 10,329,129 (GRCm39) missense probably damaging 1.00
IGL01926:Prlr APN 15 10,314,306 (GRCm39) start codon destroyed probably null 0.76
IGL01952:Prlr APN 15 10,328,428 (GRCm39) missense possibly damaging 0.95
IGL02306:Prlr APN 15 10,328,760 (GRCm39) missense probably benign 0.05
IGL02394:Prlr APN 15 10,328,664 (GRCm39) missense probably benign 0.03
IGL02430:Prlr APN 15 10,325,477 (GRCm39) missense probably damaging 1.00
IGL02695:Prlr APN 15 10,328,451 (GRCm39) missense probably benign 0.20
IGL02745:Prlr APN 15 10,328,680 (GRCm39) missense possibly damaging 0.50
IGL03193:Prlr APN 15 10,328,376 (GRCm39) missense possibly damaging 0.57
IGL03277:Prlr APN 15 10,328,887 (GRCm39) missense probably benign 0.01
IGL03379:Prlr APN 15 10,319,403 (GRCm39) missense possibly damaging 0.80
PIT4434001:Prlr UTSW 15 10,328,458 (GRCm39) missense probably damaging 1.00
R0057:Prlr UTSW 15 10,328,509 (GRCm39) missense probably damaging 0.99
R0057:Prlr UTSW 15 10,328,509 (GRCm39) missense probably damaging 0.99
R0545:Prlr UTSW 15 10,317,652 (GRCm39) missense probably damaging 1.00
R1236:Prlr UTSW 15 10,325,367 (GRCm39) missense probably benign 0.13
R1352:Prlr UTSW 15 10,328,872 (GRCm39) missense probably benign
R1524:Prlr UTSW 15 10,319,419 (GRCm39) missense probably damaging 0.97
R1537:Prlr UTSW 15 10,328,364 (GRCm39) splice site probably null
R1690:Prlr UTSW 15 10,317,676 (GRCm39) missense probably damaging 1.00
R1773:Prlr UTSW 15 10,325,404 (GRCm39) nonsense probably null
R1789:Prlr UTSW 15 10,322,622 (GRCm39) missense probably benign 0.32
R2421:Prlr UTSW 15 10,319,343 (GRCm39) missense probably damaging 1.00
R4518:Prlr UTSW 15 10,329,085 (GRCm39) missense possibly damaging 0.53
R4621:Prlr UTSW 15 10,319,462 (GRCm39) intron probably benign
R4855:Prlr UTSW 15 10,328,883 (GRCm39) missense probably benign 0.01
R4957:Prlr UTSW 15 10,319,281 (GRCm39) missense probably damaging 1.00
R5053:Prlr UTSW 15 10,325,471 (GRCm39) missense probably benign 0.00
R5731:Prlr UTSW 15 10,314,221 (GRCm39) missense probably benign 0.00
R5749:Prlr UTSW 15 10,328,804 (GRCm39) missense probably benign 0.12
R5806:Prlr UTSW 15 10,319,290 (GRCm39) missense probably damaging 1.00
R5927:Prlr UTSW 15 10,322,532 (GRCm39) missense probably benign 0.42
R6170:Prlr UTSW 15 10,328,935 (GRCm39) missense probably benign 0.05
R6911:Prlr UTSW 15 10,329,270 (GRCm39) missense probably benign
R6935:Prlr UTSW 15 10,319,388 (GRCm39) missense probably damaging 1.00
R7327:Prlr UTSW 15 10,346,524 (GRCm39) missense probably benign 0.00
R7579:Prlr UTSW 15 10,329,021 (GRCm39) missense probably benign 0.08
R7615:Prlr UTSW 15 10,326,010 (GRCm39) missense probably damaging 1.00
R7651:Prlr UTSW 15 10,328,464 (GRCm39) missense probably benign 0.26
R8213:Prlr UTSW 15 10,329,328 (GRCm39) missense possibly damaging 0.95
R8537:Prlr UTSW 15 10,314,266 (GRCm39) start gained probably benign
R9015:Prlr UTSW 15 10,319,352 (GRCm39) missense probably damaging 1.00
R9252:Prlr UTSW 15 10,326,550 (GRCm39) splice site probably benign
R9335:Prlr UTSW 15 10,325,357 (GRCm39) missense probably benign 0.08
R9341:Prlr UTSW 15 10,328,988 (GRCm39) missense probably benign
R9343:Prlr UTSW 15 10,328,988 (GRCm39) missense probably benign
Z1176:Prlr UTSW 15 10,314,341 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCCAAAAGCTTCCCTTCTG -3'
(R):5'- AGGATCCAGGTAATCCAGCCTG -3'

Sequencing Primer
(F):5'- TTCTGACAAACAAAACACATCTTGG -3'
(R):5'- GTAATCCAGCCTGCCCAGTTG -3'
Posted On 2019-10-17