Incidental Mutation 'R7557:Slc18a1'
ID584839
Institutional Source Beutler Lab
Gene Symbol Slc18a1
Ensembl Gene ENSMUSG00000036330
Gene Namesolute carrier family 18 (vesicular monoamine), member 1
Synonyms4832416I10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7557 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location69037711-69089235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69065561 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 267 (D267V)
Ref Sequence ENSEMBL: ENSMUSP00000046924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037478]
Predicted Effect probably damaging
Transcript: ENSMUST00000037478
AA Change: D267V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046924
Gene: ENSMUSG00000036330
AA Change: D267V

DomainStartEndE-ValueType
Pfam:MFS_1 24 430 3.7e-34 PFAM
Pfam:MFS_1 302 508 9e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The vesicular monoamine transporter acts to accumulate cytosolic monoamines into vesicles, using the proton gradient maintained across the vesicular membrane. Its proper function is essential to the correct activity of the monoaminergic systems that have been implicated in several human neuropsychiatric disorders. The transporter is a site of action of important drugs, including reserpine and tetrabenazine (Peter et al., 1993 [PubMed 7905859]). See also SLC18A2 (MIM 193001).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased neuron apoptosis, decreased neuron proliferation and impaired spatial object recognition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,283 Q1078* probably null Het
1190002N15Rik T C 9: 94,520,538 D357G probably damaging Het
Aatk T C 11: 120,009,430 K1310R possibly damaging Het
Acaa2 C T 18: 74,795,159 T153M possibly damaging Het
Add3 A G 19: 53,239,437 T518A probably damaging Het
AI314180 A G 4: 58,849,691 Y483H possibly damaging Het
Cacnb4 T C 2: 52,469,567 E143G probably damaging Het
Cd209a T A 8: 3,745,541 T177S probably benign Het
Chp1 T A 2: 119,560,757 Y32N probably damaging Het
Clcn3 T C 8: 60,937,368 T180A probably damaging Het
Dctn2 C A 10: 127,278,404 T373N probably benign Het
Emb T A 13: 117,249,716 N136K probably benign Het
Enpp2 A T 15: 54,910,140 C62S probably damaging Het
Fam198b A T 3: 79,886,608 K128* probably null Het
Fbxo28 G T 1: 182,341,435 A52E unknown Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Ggta1 T C 2: 35,402,536 D253G probably damaging Het
Gps1 C T 11: 120,786,367 A164V probably benign Het
Gramd4 C T 15: 86,100,900 Q146* probably null Het
Kcnh5 A T 12: 75,007,625 M515K possibly damaging Het
Klrc3 T C 6: 129,639,144 T203A probably damaging Het
Krt26 G T 11: 99,334,741 R305S probably damaging Het
Lpin1 A G 12: 16,580,792 V35A Het
Marf1 C T 16: 14,132,696 R942H probably damaging Het
Mfhas1 T A 8: 35,589,604 M411K possibly damaging Het
Mok A G 12: 110,808,399 S330P probably benign Het
Msto1 A G 3: 88,910,128 probably null Het
Olfr1490 T A 19: 13,655,026 I199N possibly damaging Het
Omg T A 11: 79,502,853 I60F possibly damaging Het
Pcdhgb4 T A 18: 37,722,794 C747* probably null Het
Pih1d1 A G 7: 45,156,759 T40A probably benign Het
Pih1d2 A T 9: 50,624,916 E290D probably damaging Het
Plce1 A G 19: 38,765,404 K1849E probably benign Het
Plekha5 T C 6: 140,426,545 Y74H probably damaging Het
Pole T G 5: 110,312,994 I1183S probably damaging Het
Ptgs1 T C 2: 36,245,211 S396P possibly damaging Het
Rasa2 T C 9: 96,557,425 E575G probably damaging Het
Sec22b A G 3: 97,901,358 T5A probably damaging Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Tcea1 T A 1: 4,894,990 C294* probably null Het
Txndc15 T A 13: 55,717,954 M77K probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r1 T A 3: 64,090,054 V377D probably damaging Het
Vmn2r7 A G 3: 64,724,973 Y23H probably benign Het
Vwa3a T A 7: 120,795,618 M887K possibly damaging Het
Zbtb5 T C 4: 44,995,196 N63D probably damaging Het
Zcchc6 T C 13: 59,788,466 I1274V possibly damaging Het
Other mutations in Slc18a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Slc18a1 APN 8 69051346 missense probably damaging 1.00
IGL00661:Slc18a1 APN 8 69073731 missense probably benign 0.00
IGL01568:Slc18a1 APN 8 69065626 missense probably damaging 1.00
IGL02199:Slc18a1 APN 8 69043980 missense probably benign 0.03
IGL03011:Slc18a1 APN 8 69038863 missense probably benign
IGL03260:Slc18a1 APN 8 69075114 missense probably benign 0.24
R0349:Slc18a1 UTSW 8 69072101 missense probably damaging 1.00
R1019:Slc18a1 UTSW 8 69075033 critical splice donor site probably null
R1759:Slc18a1 UTSW 8 69065585 missense possibly damaging 0.95
R1928:Slc18a1 UTSW 8 69073812 missense probably benign 0.00
R2058:Slc18a1 UTSW 8 69043961 missense probably damaging 1.00
R4652:Slc18a1 UTSW 8 69043931 missense possibly damaging 0.71
R4724:Slc18a1 UTSW 8 69073649 nonsense probably null
R4818:Slc18a1 UTSW 8 69040299 missense probably damaging 0.99
R6799:Slc18a1 UTSW 8 69040981 missense probably benign 0.05
R6989:Slc18a1 UTSW 8 69038862 missense probably benign 0.01
R7736:Slc18a1 UTSW 8 69065554 critical splice donor site probably null
R7956:Slc18a1 UTSW 8 69038814 missense probably benign 0.00
R8024:Slc18a1 UTSW 8 69075147 missense probably benign 0.00
R8146:Slc18a1 UTSW 8 69042749 missense possibly damaging 0.83
R8339:Slc18a1 UTSW 8 69065621 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTTCGAAGGCCATAGGATGC -3'
(R):5'- GTAGAGCTTAGTCCCCAAAGC -3'

Sequencing Primer
(F):5'- GTTATCTGGGATTCTACTAATGGCC -3'
(R):5'- GCTTAGTCCCCAAAGCCTTCAG -3'
Posted On2019-10-17