Incidental Mutation 'R7557:Txndc15'
ID584851
Institutional Source Beutler Lab
Gene Symbol Txndc15
Ensembl Gene ENSMUSG00000021497
Gene Namethioredoxin domain containing 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7557 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location55714650-55726227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55717954 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 77 (M77K)
Ref Sequence ENSEMBL: ENSMUSP00000021959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021959]
Predicted Effect probably benign
Transcript: ENSMUST00000021959
AA Change: M77K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000021959
Gene: ENSMUSG00000021497
AA Change: M77K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 174 278 8.6e-11 PFAM
transmembrane domain 305 324 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,283 Q1078* probably null Het
1190002N15Rik T C 9: 94,520,538 D357G probably damaging Het
Aatk T C 11: 120,009,430 K1310R possibly damaging Het
Acaa2 C T 18: 74,795,159 T153M possibly damaging Het
Add3 A G 19: 53,239,437 T518A probably damaging Het
AI314180 A G 4: 58,849,691 Y483H possibly damaging Het
Cacnb4 T C 2: 52,469,567 E143G probably damaging Het
Cd209a T A 8: 3,745,541 T177S probably benign Het
Chp1 T A 2: 119,560,757 Y32N probably damaging Het
Clcn3 T C 8: 60,937,368 T180A probably damaging Het
Dctn2 C A 10: 127,278,404 T373N probably benign Het
Emb T A 13: 117,249,716 N136K probably benign Het
Enpp2 A T 15: 54,910,140 C62S probably damaging Het
Fam198b A T 3: 79,886,608 K128* probably null Het
Fbxo28 G T 1: 182,341,435 A52E unknown Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Ggta1 T C 2: 35,402,536 D253G probably damaging Het
Gps1 C T 11: 120,786,367 A164V probably benign Het
Gramd4 C T 15: 86,100,900 Q146* probably null Het
Kcnh5 A T 12: 75,007,625 M515K possibly damaging Het
Klrc3 T C 6: 129,639,144 T203A probably damaging Het
Krt26 G T 11: 99,334,741 R305S probably damaging Het
Lpin1 A G 12: 16,580,792 V35A Het
Marf1 C T 16: 14,132,696 R942H probably damaging Het
Mfhas1 T A 8: 35,589,604 M411K possibly damaging Het
Mok A G 12: 110,808,399 S330P probably benign Het
Msto1 A G 3: 88,910,128 probably null Het
Olfr1490 T A 19: 13,655,026 I199N possibly damaging Het
Omg T A 11: 79,502,853 I60F possibly damaging Het
Pcdhgb4 T A 18: 37,722,794 C747* probably null Het
Pih1d1 A G 7: 45,156,759 T40A probably benign Het
Pih1d2 A T 9: 50,624,916 E290D probably damaging Het
Plce1 A G 19: 38,765,404 K1849E probably benign Het
Plekha5 T C 6: 140,426,545 Y74H probably damaging Het
Pole T G 5: 110,312,994 I1183S probably damaging Het
Ptgs1 T C 2: 36,245,211 S396P possibly damaging Het
Rasa2 T C 9: 96,557,425 E575G probably damaging Het
Sec22b A G 3: 97,901,358 T5A probably damaging Het
Slc18a1 T A 8: 69,065,561 D267V probably damaging Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Tcea1 T A 1: 4,894,990 C294* probably null Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r1 T A 3: 64,090,054 V377D probably damaging Het
Vmn2r7 A G 3: 64,724,973 Y23H probably benign Het
Vwa3a T A 7: 120,795,618 M887K possibly damaging Het
Zbtb5 T C 4: 44,995,196 N63D probably damaging Het
Zcchc6 T C 13: 59,788,466 I1274V possibly damaging Het
Other mutations in Txndc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Txndc15 APN 13 55725675 missense probably damaging 1.00
IGL01634:Txndc15 APN 13 55721625 missense probably damaging 0.99
PIT4791001:Txndc15 UTSW 13 55721694 missense probably benign 0.39
R0309:Txndc15 UTSW 13 55724582 missense probably damaging 1.00
R0480:Txndc15 UTSW 13 55724623 missense possibly damaging 0.91
R1473:Txndc15 UTSW 13 55721574 splice site probably benign
R1856:Txndc15 UTSW 13 55718062 missense possibly damaging 0.80
R4456:Txndc15 UTSW 13 55718164 missense possibly damaging 0.82
R4945:Txndc15 UTSW 13 55718165 missense probably benign 0.01
R5159:Txndc15 UTSW 13 55717921 missense probably benign
R5376:Txndc15 UTSW 13 55718219 missense probably damaging 1.00
R5776:Txndc15 UTSW 13 55718107 missense probably benign 0.01
R7365:Txndc15 UTSW 13 55714788 missense unknown
R7392:Txndc15 UTSW 13 55721586 missense probably damaging 1.00
R7679:Txndc15 UTSW 13 55725808 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTTTAGTTGCAGAGGACAGTG -3'
(R):5'- ACTTGAGGCTGTCAGTGCTG -3'

Sequencing Primer
(F):5'- TTGCAGAGGACAGTGGTCACC -3'
(R):5'- TTGGCATCCTCGGTGGCTAC -3'
Posted On2019-10-17