Incidental Mutation 'R7582:Arfgap3'
ID586827
Institutional Source Beutler Lab
Gene Symbol Arfgap3
Ensembl Gene ENSMUSG00000054277
Gene NameADP-ribosylation factor GTPase activating protein 3
Synonyms1810004P07Rik, 0610009H19Rik, 1810035F16Rik, 9130416J18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R7582 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location83299739-83350247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 83303101 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 72 (V72G)
Ref Sequence ENSEMBL: ENSMUSP00000154365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067215] [ENSMUST00000226124] [ENSMUST00000226764]
Predicted Effect probably null
Transcript: ENSMUST00000067215
SMART Domains Protein: ENSMUSP00000064893
Gene: ENSMUSG00000054277

DomainStartEndE-ValueType
ArfGap 10 126 7.18e-44 SMART
Blast:ArfGap 160 200 2e-6 BLAST
low complexity region 220 237 N/A INTRINSIC
low complexity region 348 362 N/A INTRINSIC
low complexity region 459 466 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000226124
Predicted Effect possibly damaging
Transcript: ENSMUST00000226764
AA Change: V72G

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase-activating protein (GAP) that associates with the Golgi apparatus and regulates the early secretory pathway of proteins. The encoded protein promotes hydrolysis of ADP-ribosylation factor 1 (ARF1)-bound GTP, which is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles. Dissociation of the coat proteins is a prerequisite for the fusion of these vesicles with target compartments. The activity of this protein is sensitive to phospholipids. Multiple transcript variants encoding different isoforms have been found for this gene. This gene was originally known as ARFGAP1, but that is now the name of a related but different gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,821 V1007A probably damaging Het
Adgrl3 T C 5: 81,693,676 V800A probably damaging Het
Ankfn1 T A 11: 89,526,619 M56L probably benign Het
B3galnt2 C T 13: 13,991,401 R294W probably damaging Het
Cadm1 G T 9: 47,797,442 D157Y probably damaging Het
Ccdc81 A T 7: 89,876,145 Y474N probably damaging Het
Cdkl4 T A 17: 80,533,835 K297I probably benign Het
Cep128 G A 12: 91,347,566 T146M probably damaging Het
Cfap161 T C 7: 83,777,082 N236S possibly damaging Het
Chil3 A T 3: 106,164,256 W31R probably damaging Het
Cmtm2b C T 8: 104,322,721 S86F probably damaging Het
Cntnap5a G A 1: 116,446,632 G958D probably damaging Het
Col6a5 A G 9: 105,945,426 L244P unknown Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cul9 A G 17: 46,510,979 Y1857H probably damaging Het
Dst A G 1: 34,169,883 Q1154R probably damaging Het
Fgg G A 3: 83,014,138 G376D probably damaging Het
Fmn2 T C 1: 174,698,790 S1392P probably damaging Het
Focad T C 4: 88,229,378 V418A probably benign Het
Foxf1 A T 8: 121,084,691 H98L possibly damaging Het
Frmd4a C CA 2: 4,594,597 probably null Het
Fry C A 5: 150,496,382 T639K Het
Fryl A G 5: 73,022,500 probably null Het
Gatsl3 T C 11: 4,220,457 V151A probably benign Het
Gdpd4 A G 7: 97,957,805 probably null Het
Gpt2 A G 8: 85,519,516 K368R probably damaging Het
Hc A T 2: 34,991,266 V1447E possibly damaging Het
Kmt5a A G 5: 124,459,919 T280A probably benign Het
Lrrc4b G T 7: 44,461,810 V369L probably benign Het
Ly6g5c A G 17: 35,111,807 M102V probably benign Het
Malrd1 A G 2: 15,695,270 S643G unknown Het
Mib2 T C 4: 155,654,810 N904S probably benign Het
Mug2 G A 6: 122,079,644 V1183I probably damaging Het
Nckap1l C T 15: 103,482,160 T786I probably damaging Het
Neb T C 2: 52,334,492 probably benign Het
Neu3 A G 7: 99,813,967 V183A probably benign Het
Nod1 A G 6: 54,944,307 L342P probably damaging Het
Nop58 T C 1: 59,700,938 V163A probably damaging Het
Npr3 C T 15: 11,895,682 G293R probably null Het
Obscn T A 11: 59,061,427 K3939* probably null Het
Olfr1279 T A 2: 111,306,448 M81K probably damaging Het
Olfr1426 G A 19: 12,088,006 A262V probably benign Het
Olfr180 A T 16: 58,916,047 M198K possibly damaging Het
Olfr502 A G 7: 108,523,851 I33T probably benign Het
Olfr875 T C 9: 37,772,821 L54P probably damaging Het
P2ry6 A G 7: 100,938,577 Y192H probably damaging Het
Paxbp1 A G 16: 91,022,667 probably null Het
Pign G A 1: 105,649,367 T197I probably benign Het
Pirb A T 7: 3,713,818 probably null Het
Pkdrej C A 15: 85,818,921 R938L possibly damaging Het
Psg21 A G 7: 18,647,203 *472R probably null Het
Rabgap1l A T 1: 160,682,084 S474R probably benign Het
Rrn3 C T 16: 13,810,511 Q519* probably null Het
Seh1l A T 18: 67,775,118 K37* probably null Het
Shprh A G 10: 11,164,705 S641G probably benign Het
Slc4a1 T G 11: 102,352,577 S743R probably damaging Het
Snx13 C T 12: 35,124,535 R688* probably null Het
Tlr11 C T 14: 50,361,729 Q391* probably null Het
Tmbim4 A G 10: 120,217,566 H90R probably benign Het
Trav8d-1 T C 14: 52,778,869 S71P possibly damaging Het
Trbv5 G A 6: 41,062,683 R74Q probably benign Het
Tril A G 6: 53,818,936 S434P probably benign Het
Uhmk1 A G 1: 170,200,001 Y376H probably damaging Het
Uty A G Y: 1,170,914 C317R probably damaging Het
Vmp1 C T 11: 86,585,399 C377Y probably benign Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdr41 T C 13: 95,005,767 S150P probably damaging Het
Zfp617 T A 8: 71,932,020 Y65N probably benign Het
Zfp800 A C 6: 28,244,090 V292G probably damaging Het
Other mutations in Arfgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Arfgap3 APN 15 83322589 missense probably benign 0.04
IGL01306:Arfgap3 APN 15 83313509 missense possibly damaging 0.78
IGL01960:Arfgap3 APN 15 83313557 missense probably benign 0.04
IGL03029:Arfgap3 APN 15 83322650 missense probably damaging 1.00
IGL03036:Arfgap3 APN 15 83306926 missense possibly damaging 0.91
IGL03328:Arfgap3 APN 15 83343081 missense probably damaging 1.00
ANU23:Arfgap3 UTSW 15 83313509 missense possibly damaging 0.78
R0103:Arfgap3 UTSW 15 83322721 splice site probably benign
R0103:Arfgap3 UTSW 15 83322721 splice site probably benign
R0125:Arfgap3 UTSW 15 83343139 missense probably benign 0.01
R0243:Arfgap3 UTSW 15 83330513 splice site probably benign
R0551:Arfgap3 UTSW 15 83343137 missense probably damaging 1.00
R0557:Arfgap3 UTSW 15 83303185 missense probably damaging 1.00
R0638:Arfgap3 UTSW 15 83308188 splice site probably null
R1115:Arfgap3 UTSW 15 83330540 missense probably benign 0.00
R1459:Arfgap3 UTSW 15 83306937 missense probably benign 0.15
R1576:Arfgap3 UTSW 15 83313563 missense possibly damaging 0.94
R1776:Arfgap3 UTSW 15 83343139 missense probably benign 0.01
R1826:Arfgap3 UTSW 15 83303102 critical splice donor site probably null
R2057:Arfgap3 UTSW 15 83310300 missense probably benign
R2084:Arfgap3 UTSW 15 83334566 missense probably damaging 0.96
R3407:Arfgap3 UTSW 15 83322607 missense probably benign 0.00
R4072:Arfgap3 UTSW 15 83303129 missense probably damaging 1.00
R4074:Arfgap3 UTSW 15 83303129 missense probably damaging 1.00
R4206:Arfgap3 UTSW 15 83322668 missense probably benign
R4449:Arfgap3 UTSW 15 83334558 missense probably damaging 1.00
R5004:Arfgap3 UTSW 15 83310296 missense possibly damaging 0.87
R5193:Arfgap3 UTSW 15 83332697 missense probably benign 0.01
R5364:Arfgap3 UTSW 15 83314361 missense probably damaging 1.00
R6142:Arfgap3 UTSW 15 83350127 missense probably damaging 1.00
R6813:Arfgap3 UTSW 15 83330593 missense probably benign 0.00
R7154:Arfgap3 UTSW 15 83336704 missense probably damaging 1.00
R7422:Arfgap3 UTSW 15 83306949 missense probably damaging 0.97
R7714:Arfgap3 UTSW 15 83308151 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- ATACGAACTCCAGTAGGAACTTAG -3'
(R):5'- ACATGTCCTTAGAAGAGGGGC -3'

Sequencing Primer
(F):5'- TCTACAGAGTGAGTTCCAGGAC -3'
(R):5'- AGGGGCAAGCTGACATCTTTC -3'
Posted On2019-10-24