Incidental Mutation 'R0233:Cuzd1'
ID58898
Institutional Source Beutler Lab
Gene Symbol Cuzd1
Ensembl Gene ENSMUSG00000040205
Gene NameCUB and zona pellucida-like domains 1
SynonymsERG-1, UTCZP, UO-44, Itmap1
MMRRC Submission 038474-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R0233 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location131308554-131322292 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 131311816 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 357 (K357N)
Ref Sequence ENSEMBL: ENSMUSP00000037168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046611] [ENSMUST00000124096]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046611
AA Change: K357N

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037168
Gene: ENSMUSG00000040205
AA Change: K357N

DomainStartEndE-ValueType
CUB 32 146 1.78e-16 SMART
CUB 154 265 1.1e-44 SMART
ZP 276 519 1.39e-63 SMART
transmembrane domain 571 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 99% (93/94)
MGI Phenotype PHENOTYPE: Female mice homozygous for disruption of this gene exhibit impaired mammary gland development during puberty and during and following pregnancy and do not lactate. Homozygous mutant mice show an increased susceptibility to induced pancreatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,663,373 S212P probably benign Het
4932438A13Rik T A 3: 36,948,563 C1552* probably null Het
A730018C14Rik A C 12: 112,415,430 noncoding transcript Het
Acsf3 A G 8: 122,780,292 Y108C probably damaging Het
Acsl1 A G 8: 46,513,569 probably benign Het
Adad1 T A 3: 37,084,948 I389N possibly damaging Het
Ankrd27 T C 7: 35,601,560 L95P probably damaging Het
Ano5 T C 7: 51,535,470 F46S possibly damaging Het
Ap2a1 T C 7: 44,915,973 N114S probably damaging Het
Arap1 C T 7: 101,400,241 S970L possibly damaging Het
Atad3a A T 4: 155,746,067 S525T probably damaging Het
B4galnt1 T C 10: 127,170,911 probably benign Het
Cacna2d2 A T 9: 107,514,670 I463F probably damaging Het
Casp6 T A 3: 129,905,975 N34K probably damaging Het
Ccdc175 A T 12: 72,105,876 F752I probably benign Het
Cdhr4 A G 9: 107,996,934 I76V probably benign Het
Copa T C 1: 172,087,667 probably null Het
Cox11 C T 11: 90,644,500 T259I probably damaging Het
Dnah5 T A 15: 28,333,070 F2206I probably damaging Het
Dnase2b T A 3: 146,582,550 K263N probably benign Het
Dync1h1 T A 12: 110,640,980 D2668E probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam124b T C 1: 80,212,986 S227G probably damaging Het
Fam13b T A 18: 34,448,084 Y675F probably damaging Het
Fgf21 T A 7: 45,615,297 M4L probably benign Het
Flg2 T A 3: 93,201,797 C377* probably null Het
Foxp2 T C 6: 15,409,753 S451P probably damaging Het
Gli2 A T 1: 118,835,925 S1499T probably damaging Het
Gm13078 A T 4: 143,726,063 E21D possibly damaging Het
Gm8909 A G 17: 36,167,469 Y224H probably benign Het
Gm9920 A T 15: 55,112,461 probably benign Het
Gpx5 T A 13: 21,287,403 D210V probably damaging Het
Hoxb5 T A 11: 96,305,027 S234T probably benign Het
Irf9 C A 14: 55,606,094 N140K probably benign Het
Isg20 C T 7: 78,914,495 T50M probably damaging Het
Isg20 C A 7: 78,916,586 D94E probably damaging Het
Izumo1 T C 7: 45,624,168 L115P probably damaging Het
Kdm3b G A 18: 34,809,420 E655K probably damaging Het
Kdm5b T G 1: 134,604,634 probably benign Het
Kifc3 A G 8: 95,101,472 probably null Het
Kpna2 T C 11: 106,992,631 S111G probably benign Het
Krt73 A T 15: 101,802,016 N94K probably benign Het
Lgmn G T 12: 102,399,989 D247E probably damaging Het
Lilra6 C T 7: 3,914,936 V70I possibly damaging Het
Lrig3 G A 10: 126,013,526 probably null Het
Lrrc4 T C 6: 28,829,735 H627R probably benign Het
Macf1 G A 4: 123,450,127 probably benign Het
Nat9 C A 11: 115,183,408 probably null Het
Nutm2 A G 13: 50,467,405 D2G probably benign Het
Olfr1151 A G 2: 87,857,752 I192M probably benign Het
Olfr1404 A T 1: 173,216,301 I217F probably benign Het
Olfr191 A T 16: 59,085,675 D269E probably benign Het
Parl G A 16: 20,287,907 P184L probably damaging Het
Pdzd8 A T 19: 59,300,379 M863K probably damaging Het
Phlda3 T C 1: 135,766,821 S125P probably damaging Het
Pkd1l3 A T 8: 109,650,780 R217* probably null Het
Plekhg5 T C 4: 152,112,219 C695R probably damaging Het
Prg4 T C 1: 150,453,547 probably benign Het
Prkab1 A G 5: 116,021,652 probably benign Het
Pyroxd1 A G 6: 142,354,630 E162G possibly damaging Het
R3hcc1l G A 19: 42,582,921 probably null Het
Rgs12 T A 5: 35,030,498 S500T probably damaging Het
Ripor3 T C 2: 167,992,598 D299G probably damaging Het
Robo4 T C 9: 37,402,681 L76P probably damaging Het
Sbno1 T C 5: 124,376,226 Y1302C probably damaging Het
Sec63 A G 10: 42,823,908 I655V possibly damaging Het
Serpina11 T A 12: 103,980,470 M389L probably benign Het
Sfswap C A 5: 129,554,543 P745Q possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slitrk3 C T 3: 73,048,577 S954N probably benign Het
Sorbs2 A G 8: 45,769,829 T190A probably damaging Het
Sos2 A T 12: 69,617,330 I460N probably benign Het
Spink7 T A 18: 62,594,352 I34L probably benign Het
Srbd1 A G 17: 86,057,745 S628P probably damaging Het
Srm G A 4: 148,593,372 G156S probably damaging Het
Sulf2 T C 2: 166,085,669 probably benign Het
Tmc4 T A 7: 3,666,867 Y6F probably benign Het
Tmcc2 A G 1: 132,360,651 F433L probably damaging Het
Tmprss13 T G 9: 45,337,100 probably benign Het
Tnxb T C 17: 34,699,033 F2307L probably benign Het
Tsr3 A G 17: 25,242,510 E274G probably benign Het
Ttn T C 2: 76,895,144 probably benign Het
Tub T C 7: 109,029,341 V352A possibly damaging Het
Tubb2a A G 13: 34,075,342 I155T possibly damaging Het
Ugt2a2 T C 5: 87,475,001 N36S probably damaging Het
Usp13 T A 3: 32,915,664 probably null Het
Vmn1r52 T G 6: 90,179,611 L120R possibly damaging Het
Vmn2r11 A T 5: 109,054,102 S179T probably benign Het
Vwf A T 6: 125,686,510 R2805W possibly damaging Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp286 T C 11: 62,780,393 T285A possibly damaging Het
Other mutations in Cuzd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Cuzd1 APN 7 131316136 missense probably damaging 0.99
IGL01140:Cuzd1 APN 7 131311794 missense probably damaging 1.00
IGL01773:Cuzd1 APN 7 131314885 missense probably damaging 1.00
IGL02960:Cuzd1 APN 7 131320103 missense probably benign 0.01
PIT4504001:Cuzd1 UTSW 7 131309800 missense possibly damaging 0.88
R0233:Cuzd1 UTSW 7 131311816 missense possibly damaging 0.61
R0363:Cuzd1 UTSW 7 131316262 missense probably benign 0.16
R0375:Cuzd1 UTSW 7 131311908 intron probably benign
R0446:Cuzd1 UTSW 7 131316280 splice site probably null
R0482:Cuzd1 UTSW 7 131309872 unclassified probably benign
R0765:Cuzd1 UTSW 7 131316095 missense probably benign 0.40
R0932:Cuzd1 UTSW 7 131320194 intron probably benign
R1463:Cuzd1 UTSW 7 131316642 missense probably damaging 1.00
R1533:Cuzd1 UTSW 7 131311703 missense probably damaging 0.99
R1722:Cuzd1 UTSW 7 131311644 missense probably damaging 0.96
R1920:Cuzd1 UTSW 7 131309696 missense probably benign 0.00
R2027:Cuzd1 UTSW 7 131320091 missense possibly damaging 0.93
R2039:Cuzd1 UTSW 7 131309616 missense probably benign 0.00
R2039:Cuzd1 UTSW 7 131314914 intron probably benign
R2857:Cuzd1 UTSW 7 131316134 missense probably damaging 0.97
R2859:Cuzd1 UTSW 7 131316134 missense probably damaging 0.97
R4585:Cuzd1 UTSW 7 131314800 missense probably damaging 1.00
R4586:Cuzd1 UTSW 7 131314800 missense probably damaging 1.00
R4830:Cuzd1 UTSW 7 131318054 missense probably damaging 0.99
R4945:Cuzd1 UTSW 7 131316621 missense probably damaging 1.00
R5009:Cuzd1 UTSW 7 131311523 missense probably damaging 1.00
R5337:Cuzd1 UTSW 7 131316074 missense probably damaging 1.00
R5355:Cuzd1 UTSW 7 131316124 missense probably damaging 1.00
R6543:Cuzd1 UTSW 7 131309768 missense probably damaging 1.00
R6569:Cuzd1 UTSW 7 131311757 missense probably damaging 1.00
R6681:Cuzd1 UTSW 7 131311683 missense probably damaging 1.00
R6818:Cuzd1 UTSW 7 131316665 missense probably damaging 1.00
R6819:Cuzd1 UTSW 7 131309731 missense possibly damaging 0.51
R7031:Cuzd1 UTSW 7 131308851 missense probably benign 0.22
R7524:Cuzd1 UTSW 7 131311618 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTGCTGGGAAATACACGAGCAC -3'
(R):5'- AGGTCAGGCCCTGCCGTAAAATAC -3'

Sequencing Primer
(F):5'- GAGGCTCTGCAAGTATCCAG -3'
(R):5'- GCCCTGCCGTAAAATACATGTTAG -3'
Posted On2013-07-11