Incidental Mutation 'R7619:Dmc1'
ID589070
Institutional Source Beutler Lab
Gene Symbol Dmc1
Ensembl Gene ENSMUSG00000022429
Gene NameDNA meiotic recombinase 1
SynonymsDmc1h, sgdp, Dmc1, Mei11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.789) question?
Stock #R7619 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location79561497-79605109 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 79596242 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023065] [ENSMUST00000229408] [ENSMUST00000230011]
Predicted Effect probably null
Transcript: ENSMUST00000023065
SMART Domains Protein: ENSMUSP00000023065
Gene: ENSMUSG00000022429

DomainStartEndE-ValueType
HhH1 57 76 8.07e0 SMART
AAA 118 307 2.79e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000229408
Predicted Effect probably benign
Transcript: ENSMUST00000230011
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: This gene encodes a member of the superfamily of recombinases (also called DNA strand-exchange proteins). Recombinases are important for repairing double-strand DNA breaks during mitosis and meiosis. This protein, which is evolutionarily conserved, is reported to be essential for meiotic homologous recombination and may thus play an important role in generating diversity of genetic information. In mouse, deficiency of this gene causes infertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for targeted mutations are sterile with failure of homologous pairing in meiotic prophase in males and disrupted oogenesis in embryonic females with absence of germ cells in the adult ovary. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C G 16: 14,445,419 P748A probably damaging Het
Abcc12 A G 8: 86,566,553 V2A probably damaging Het
Anxa3 T C 5: 96,830,404 Y216H probably damaging Het
Arpc1a C A 5: 145,104,858 T317K probably benign Het
C330018D20Rik A G 18: 56,962,411 L34S probably damaging Het
C5ar1 A G 7: 16,248,579 F172S probably damaging Het
Ccl27a G A 4: 41,774,166 probably benign Het
Clip1 T C 5: 123,614,279 N480D Het
Cttnbp2nl A G 3: 105,004,760 S603P possibly damaging Het
Dnhd1 A G 7: 105,674,268 I626V probably benign Het
Dnm2 A G 9: 21,505,634 N821S probably benign Het
Dst T C 1: 34,199,428 L1723S probably benign Het
Ep300 T A 15: 81,608,198 M245K unknown Het
Fam227a T C 15: 79,617,766 T536A probably benign Het
Fbn2 G T 18: 58,080,227 R963S possibly damaging Het
Fbxo42 T G 4: 141,200,362 I651S possibly damaging Het
Ggnbp1 T A 17: 27,018,131 M1K probably null Het
Gm10800 AAAGAAAACTGAA ACAAGAAAACTGAA 2: 98,667,033 probably null Het
Gm12794 T G 4: 101,941,300 F156C probably benign Het
Grid2 T C 6: 63,931,101 F242L possibly damaging Het
Igf2r A G 17: 12,698,273 V1580A possibly damaging Het
March4 A G 1: 72,534,989 V50A possibly damaging Het
Mettl15 T A 2: 109,092,875 R401* probably null Het
Mki67 A T 7: 135,699,377 H1309Q probably benign Het
Mtor T C 4: 148,462,795 Y412H probably damaging Het
Myef2 C T 2: 125,123,476 G15S probably benign Het
Napepld A T 5: 21,675,848 I183N probably damaging Het
Nbeal2 T C 9: 110,625,818 E2644G probably benign Het
Neb C T 2: 52,296,426 R878Q possibly damaging Het
Olfr685 A G 7: 105,180,749 V203A probably damaging Het
Otol1 A T 3: 70,027,869 H398L probably damaging Het
Pcdhga9 A G 18: 37,738,752 S545G probably damaging Het
Rhbdl1 T C 17: 25,837,017 S4G possibly damaging Het
Ric1 A G 19: 29,579,775 E420G probably benign Het
Sap30l G A 11: 57,808,061 R120H probably damaging Het
Scn2a T C 2: 65,715,903 F937L probably damaging Het
Sdf2 G A 11: 78,251,163 G108D probably damaging Het
Skint5 T C 4: 113,524,108 S1263G unknown Het
Stab1 A G 14: 31,145,237 I1722T probably benign Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Tcp11l2 T C 10: 84,594,758 F249S probably damaging Het
Thoc7 T A 14: 13,961,819 probably null Het
Tvp23a C A 16: 10,428,738 C61F probably damaging Het
Ubfd1 G A 7: 122,067,383 G34D probably benign Het
Vmn1r160 A T 7: 22,871,542 T107S probably damaging Het
Vmn2r108 T A 17: 20,472,195 K133I probably benign Het
Vmn2r15 A T 5: 109,288,324 probably null Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Zfp354c C T 11: 50,817,808 probably null Het
Zfp560 G T 9: 20,348,910 Q219K probably benign Het
Zfp691 C T 4: 119,170,984 G17E probably damaging Het
Zfp930 T A 8: 69,209,158 M1K probably null Het
Zkscan14 A G 5: 145,195,359 F454S probably benign Het
Other mutations in Dmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Dmc1 APN 15 79596280 missense probably benign 0.11
IGL02817:Dmc1 APN 15 79588763 missense probably damaging 1.00
IGL03131:Dmc1 APN 15 79568691 missense probably benign 0.02
IGL03341:Dmc1 APN 15 79562545 missense probably benign 0.01
R0129:Dmc1 UTSW 15 79596240 splice site probably benign
R0395:Dmc1 UTSW 15 79588772 missense probably damaging 1.00
R0908:Dmc1 UTSW 15 79585689 missense probably damaging 1.00
R2219:Dmc1 UTSW 15 79585126 missense possibly damaging 0.77
R3706:Dmc1 UTSW 15 79562581 missense probably damaging 1.00
R6362:Dmc1 UTSW 15 79588823 missense probably benign 0.42
R7499:Dmc1 UTSW 15 79602420 nonsense probably null
R8270:Dmc1 UTSW 15 79601545 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCAGGAAAAGAAACATGGACTCC -3'
(R):5'- GACCTCGATACATGTATTGCTGG -3'

Sequencing Primer
(F):5'- GACTGCTCTTCCAAAGGTCATGAG -3'
(R):5'- CGATACATGTATTGCTGGGAGGC -3'
Posted On2019-10-24