Incidental Mutation 'R8270:Dmc1'
ID639468
Institutional Source Beutler Lab
Gene Symbol Dmc1
Ensembl Gene ENSMUSG00000022429
Gene NameDNA meiotic recombinase 1
SynonymsDmc1h, sgdp, Dmc1, Mei11
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.693) question?
Stock #R8270 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location79561497-79605109 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79601545 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 23 (D23G)
Ref Sequence ENSEMBL: ENSMUSP00000023065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023065]
Predicted Effect probably damaging
Transcript: ENSMUST00000023065
AA Change: D23G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023065
Gene: ENSMUSG00000022429
AA Change: D23G

DomainStartEndE-ValueType
HhH1 57 76 8.07e0 SMART
AAA 118 307 2.79e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the superfamily of recombinases (also called DNA strand-exchange proteins). Recombinases are important for repairing double-strand DNA breaks during mitosis and meiosis. This protein, which is evolutionarily conserved, is reported to be essential for meiotic homologous recombination and may thus play an important role in generating diversity of genetic information. In mouse, deficiency of this gene causes infertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for targeted mutations are sterile with failure of homologous pairing in meiotic prophase in males and disrupted oogenesis in embryonic females with absence of germ cells in the adult ovary. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,503,044 T3044I probably damaging Het
Apbb1ip C T 2: 22,874,992 P562S unknown Het
Arhgap44 A G 11: 65,022,034 M477T possibly damaging Het
Arhgef12 T C 9: 42,971,058 T1497A probably benign Het
Atp5h T C 11: 115,416,872 D91G probably damaging Het
Atp6v0a4 A G 6: 38,074,229 F405L probably damaging Het
Bicc1 T A 10: 70,932,108 T893S probably damaging Het
Cacna1i T A 15: 80,373,634 C1122S probably damaging Het
Capn7 A G 14: 31,358,679 E369G probably damaging Het
Cass4 T A 2: 172,427,669 L557Q probably damaging Het
Cdh5 A G 8: 104,113,040 I48V probably benign Het
Crisp3 T C 17: 40,235,922 K35R probably benign Het
Csde1 G A 3: 103,038,755 A22T possibly damaging Het
Ctse T C 1: 131,668,139 Y190H probably damaging Het
Cyp2d34 T A 15: 82,620,787 D24V possibly damaging Het
D630045J12Rik A T 6: 38,190,723 Y981* probably null Het
Dclre1a G A 19: 56,544,950 T404I possibly damaging Het
Dnah8 C T 17: 30,840,713 T4429M probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fn3k A T 11: 121,439,311 M107L probably benign Het
Fxyd5 A G 7: 31,041,429 L10P probably damaging Het
Gm4922 C T 10: 18,784,012 D321N probably benign Het
Gm7714 T C 5: 88,282,524 V93A possibly damaging Het
Gm884 T C 11: 103,543,315 I3009M unknown Het
Gtf2h3 A G 5: 124,595,987 *310W probably null Het
Hapln2 G A 3: 88,023,544 T180I possibly damaging Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Iqgap1 A G 7: 80,730,127 V1166A probably damaging Het
Kcnk10 T C 12: 98,435,099 N439S Het
Klhl3 A T 13: 58,113,154 M15K Het
Klk1b26 A T 7: 44,016,120 T151S probably benign Het
Krtap5-1 C A 7: 142,296,462 C176F unknown Het
Krtap5-3 T A 7: 142,201,956 C177S unknown Het
Map1a T C 2: 121,299,020 F180L probably damaging Het
Mfap5 T C 6: 122,521,930 probably null Het
Nckap1 T A 2: 80,524,664 H638L possibly damaging Het
Olfr506 T A 7: 108,612,943 I212N probably benign Het
Olfr910 T G 9: 38,539,348 M151R noncoding transcript Het
Optc C T 1: 133,905,072 V97M probably benign Het
Piezo1 A G 8: 122,501,559 Y330H Het
Ppp1r12b G T 1: 134,876,148 N424K probably benign Het
Prdm5 T A 6: 65,936,074 F580L probably damaging Het
Prr27 A C 5: 87,846,312 K348N possibly damaging Het
Prr30 A G 14: 101,198,386 Y247H possibly damaging Het
Sec24d T C 3: 123,305,886 V336A possibly damaging Het
Serac1 A T 17: 6,050,758 L457H probably damaging Het
Serpina1f A G 12: 103,693,498 I175T probably damaging Het
Sspo A T 6: 48,449,963 H242L probably benign Het
Tcaf2 A T 6: 42,630,024 M332K probably benign Het
Tnrc6a T A 7: 123,170,071 N361K possibly damaging Het
Trim43b G T 9: 89,085,405 H393N possibly damaging Het
Ush2a T C 1: 188,444,641 L1334S probably benign Het
Usp35 T C 7: 97,312,344 E625G probably benign Het
Other mutations in Dmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Dmc1 APN 15 79596280 missense probably benign 0.11
IGL02817:Dmc1 APN 15 79588763 missense probably damaging 1.00
IGL03131:Dmc1 APN 15 79568691 missense probably benign 0.02
IGL03341:Dmc1 APN 15 79562545 missense probably benign 0.01
R0129:Dmc1 UTSW 15 79596240 splice site probably benign
R0395:Dmc1 UTSW 15 79588772 missense probably damaging 1.00
R0908:Dmc1 UTSW 15 79585689 missense probably damaging 1.00
R2219:Dmc1 UTSW 15 79585126 missense possibly damaging 0.77
R3706:Dmc1 UTSW 15 79562581 missense probably damaging 1.00
R6362:Dmc1 UTSW 15 79588823 missense probably benign 0.42
R7499:Dmc1 UTSW 15 79602420 nonsense probably null
R7619:Dmc1 UTSW 15 79596242 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCATGGGGTTGGTTCTCATATAC -3'
(R):5'- CCCTAGGACATTCATTGTTGGTG -3'

Sequencing Primer
(F):5'- CACCAGGCACATTGCTAA -3'
(R):5'- ACATTCATTGTTGGTGCATGTTC -3'
Posted On2020-07-28