Incidental Mutation 'R7684:Fzd10'
ID 592933
Institutional Source Beutler Lab
Gene Symbol Fzd10
Ensembl Gene ENSMUSG00000081683
Gene Name frizzled class receptor 10
Synonyms Fz-10
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7684 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 128600844-128604093 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128601416 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 67 (I67V)
Ref Sequence ENSEMBL: ENSMUSP00000114114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117102]
AlphaFold Q8BKG4
Predicted Effect possibly damaging
Transcript: ENSMUST00000117102
AA Change: I67V

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114114
Gene: ENSMUSG00000081683
AA Change: I67V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FRI 34 153 7.83e-68 SMART
Frizzled 218 542 2.62e-207 SMART
Meta Mutation Damage Score 0.1222 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the frizzled gene family. Members of this family encode 7-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. Using array analysis, expression of this intronless gene is significantly up-regulated in two cases of primary colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,540 K1239* probably null Het
Abhd6 T C 14: 8,039,807 F60S probably damaging Het
Adam6b G A 12: 113,491,576 W671* probably null Het
Ankrd36 A G 11: 5,570,113 T63A possibly damaging Het
Arhgef16 A G 4: 154,281,828 V494A possibly damaging Het
Arhgef7 T A 8: 11,819,663 M659K probably benign Het
Cacna1h A G 17: 25,389,372 Y854H probably damaging Het
Chd3 A T 11: 69,357,866 F780I possibly damaging Het
Cldn8 A G 16: 88,562,447 Y197H probably damaging Het
Cpne8 A T 15: 90,649,247 D58E probably damaging Het
Cul9 T G 17: 46,509,889 Y1954S probably damaging Het
Cyp4a10 T A 4: 115,518,352 F11I probably benign Het
Cysrt1 A T 2: 25,239,082 C139* probably null Het
Dnajc16 A G 4: 141,774,568 V317A probably benign Het
Dnmt3a T C 12: 3,897,340 V437A probably benign Het
Dok5 T C 2: 170,841,424 C202R probably damaging Het
Dusp11 T A 6: 85,950,560 R164S probably damaging Het
Dysf T C 6: 84,100,135 S648P probably benign Het
Egfem1 A T 3: 29,690,185 R581S probably damaging Het
Enpep A G 3: 129,321,445 F226S probably damaging Het
Ep400 A G 5: 110,697,352 I1541T unknown Het
Exd1 A G 2: 119,520,203 S526P probably damaging Het
Fam118a A G 15: 85,058,781 E337G possibly damaging Het
Fam20b T C 1: 156,690,645 N193S probably benign Het
Fat3 A G 9: 15,988,268 probably null Het
Flg2 T C 3: 93,219,649 V1956A unknown Het
Gckr A T 5: 31,307,797 D370V probably damaging Het
Gm8797 A T 3: 5,751,088 Q62L probably benign Het
H6pd G T 4: 149,996,062 Q109K probably benign Het
Higd1a T C 9: 121,850,256 K55R possibly damaging Het
Il1b C T 2: 129,367,357 V118I probably benign Het
Insr T C 8: 3,169,753 N923S possibly damaging Het
Krit1 A G 5: 3,830,723 I561V possibly damaging Het
Lamc2 T C 1: 153,127,025 D1070G probably null Het
Lpcat2 T A 8: 92,909,195 D408E possibly damaging Het
Mst1r T A 9: 107,911,563 F427Y probably benign Het
Mtx1 A T 3: 89,210,432 I258K possibly damaging Het
Nckap5 T C 1: 126,026,857 T653A probably benign Het
Npas3 A T 12: 54,068,826 N844Y probably damaging Het
Nrg3 A T 14: 39,472,565 L79Q probably damaging Het
Nsmce1 C A 7: 125,471,176 K154N probably damaging Het
Oard1 T C 17: 48,416,698 L124P probably damaging Het
Olfr1122 T C 2: 87,388,028 S108P probably damaging Het
Olfr1337 T C 4: 118,782,274 M104V probably benign Het
Olfr615 T C 7: 103,561,218 F247S probably benign Het
Olfr642 G A 7: 104,049,460 T298I probably damaging Het
Ovgp1 A T 3: 105,979,956 T223S probably damaging Het
Pik3c2a A T 7: 116,388,077 Y536* probably null Het
Plekho2 A T 9: 65,559,534 probably null Het
Prelid3b T C 2: 174,468,417 probably null Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rxfp1 T A 3: 79,670,907 N159I possibly damaging Het
Sfmbt1 A G 14: 30,810,354 Q557R probably damaging Het
Slc22a18 G T 7: 143,490,840 V177L probably benign Het
Slc22a8 A G 19: 8,609,930 I451M probably benign Het
Slc39a12 T C 2: 14,449,859 S563P probably damaging Het
Snx20 T C 8: 88,627,235 D289G probably benign Het
Sptb A G 12: 76,612,195 Y1189H probably benign Het
Tbc1d1 T A 5: 64,316,486 M784K probably benign Het
Tbkbp1 T C 11: 97,147,733 probably benign Het
Tfap2b G C 1: 19,214,287 D140H probably damaging Het
Thy1 G A 9: 44,046,558 G13D unknown Het
Ticam1 A G 17: 56,269,984 S704P unknown Het
Tmem151b A G 17: 45,547,003 Y106H probably damaging Het
Trappc8 T C 18: 20,863,502 N452S probably benign Het
Ttc9c A G 19: 8,811,764 Y166H probably damaging Het
Txndc16 A G 14: 45,147,868 V556A possibly damaging Het
Tyrp1 C A 4: 80,840,625 S245Y probably damaging Het
Urb1 A T 16: 90,786,118 L621* probably null Het
Wdr72 A T 9: 74,147,010 T224S probably damaging Het
Zc3h18 T G 8: 122,407,426 S544A unknown Het
Zfp462 T A 4: 55,008,908 N291K probably benign Het
Zfp609 T C 9: 65,731,080 N290S possibly damaging Het
Zfp979 A T 4: 147,613,342 H303Q probably damaging Het
Other mutations in Fzd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Fzd10 APN 5 128601528 missense probably damaging 1.00
IGL02354:Fzd10 APN 5 128601868 missense possibly damaging 0.89
IGL02361:Fzd10 APN 5 128601868 missense possibly damaging 0.89
IGL03088:Fzd10 APN 5 128602605 missense possibly damaging 0.81
R0530:Fzd10 UTSW 5 128602013 missense probably damaging 1.00
R0645:Fzd10 UTSW 5 128602598 missense possibly damaging 0.94
R1515:Fzd10 UTSW 5 128602559 missense probably damaging 1.00
R3930:Fzd10 UTSW 5 128602412 missense probably damaging 1.00
R4467:Fzd10 UTSW 5 128601276 missense probably benign 0.01
R4976:Fzd10 UTSW 5 128602114 nonsense probably null
R5156:Fzd10 UTSW 5 128601302 missense possibly damaging 0.68
R5202:Fzd10 UTSW 5 128602116 missense possibly damaging 0.78
R5874:Fzd10 UTSW 5 128601300 missense probably benign 0.41
R6238:Fzd10 UTSW 5 128602931 missense probably damaging 0.99
R6921:Fzd10 UTSW 5 128601582 missense probably damaging 0.99
R8093:Fzd10 UTSW 5 128602239 missense probably benign 0.14
R9011:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9013:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9014:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9332:Fzd10 UTSW 5 128601252 missense possibly damaging 0.92
Z1088:Fzd10 UTSW 5 128601246 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCTGCAGGTGATGATAGGC -3'
(R):5'- ACTTGCCTGGGTTGTCACAAC -3'

Sequencing Primer
(F):5'- ATGATAGGCTCGTGCACG -3'
(R):5'- GGCCACCTGAATTTGAACTG -3'
Posted On 2019-11-12