Incidental Mutation 'R7724:Adarb2'
ID595415
Institutional Source Beutler Lab
Gene Symbol Adarb2
Ensembl Gene ENSMUSG00000052551
Gene Nameadenosine deaminase, RNA-specific, B2
SynonymsAdar3, RED2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7724 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location8202866-8768747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 8570256 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 259 (H259Q)
Ref Sequence ENSEMBL: ENSMUSP00000064775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064473] [ENSMUST00000123187] [ENSMUST00000135574]
Predicted Effect probably benign
Transcript: ENSMUST00000064473
AA Change: H259Q

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000064775
Gene: ENSMUSG00000052551
AA Change: H259Q

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
DSRM 126 190 1.03e-16 SMART
DSRM 284 346 1.24e-15 SMART
ADEAMc 366 742 5.41e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123187
AA Change: H259Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000120757
Gene: ENSMUSG00000052551
AA Change: H259Q

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
DSRM 126 190 6.1e-19 SMART
DSRM 284 346 7.3e-18 SMART
ADEAMc 366 698 2e-164 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135574
AA Change: H259Q

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115148
Gene: ENSMUSG00000052551
AA Change: H259Q

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
DSRM 126 190 1.03e-16 SMART
DSRM 284 346 1.24e-15 SMART
ADEAMc 366 742 5.41e-211 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the double-stranded RNA adenosine deaminase family of RNA-editing enzymes and may play a regulatory role in RNA editing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,250 N148D possibly damaging Het
9130401M01Rik A C 15: 58,022,461 S342A probably benign Het
Ak7 T A 12: 105,716,030 I150N probably damaging Het
Arhgef12 A T 9: 43,027,271 I75N probably damaging Het
Arhgef17 C T 7: 100,880,609 G480S probably damaging Het
Atic T C 1: 71,564,901 Y208H probably damaging Het
Atp8b4 T A 2: 126,322,893 N1168Y possibly damaging Het
Cdh15 G T 8: 122,866,961 D765Y probably damaging Het
Celf4 C T 18: 25,486,793 probably null Het
Cep57l1 G A 10: 41,745,842 T26M possibly damaging Het
Ces2g T A 8: 104,966,852 D388E probably benign Het
Cir1 T C 2: 73,306,890 N69S possibly damaging Het
Ctc1 C A 11: 69,026,344 H355N probably benign Het
Ebf2 A T 14: 67,424,040 K539M probably damaging Het
Ehbp1 G A 11: 22,089,572 H843Y probably null Het
Fat2 C T 11: 55,284,796 G1697E probably damaging Het
Fga A G 3: 83,029,125 D76G probably damaging Het
Fn1 A T 1: 71,603,735 S1786T probably benign Het
Frmpd1 A T 4: 45,229,888 E18D probably damaging Het
Gbp8 A T 5: 105,031,294 I113N probably damaging Het
Gm10549 A T 18: 33,470,859 R132* probably null Het
Gmps T A 3: 63,985,653 D126E possibly damaging Het
Gria4 A G 9: 4,472,074 Y472H probably damaging Het
Helz2 T C 2: 181,231,996 Y2235C probably damaging Het
Hrnr A G 3: 93,323,016 N187S unknown Het
Ifit1bl1 T C 19: 34,594,005 K351E probably benign Het
Klhl23 A G 2: 69,824,712 T309A probably benign Het
Ldhal6b A G 17: 5,418,602 V19A probably benign Het
Lrrc59 C T 11: 94,643,344 R243C probably damaging Het
Magi3 A C 3: 104,015,927 I1158R probably benign Het
Mical2 T A 7: 112,323,626 Y613N probably damaging Het
Myoc T A 1: 162,639,827 probably null Het
Npas3 C A 12: 54,068,341 S682Y possibly damaging Het
Ogdh T C 11: 6,324,887 V172A probably benign Het
Olfr1076 A G 2: 86,508,605 T49A probably damaging Het
Olfr284 A T 15: 98,340,894 S32T possibly damaging Het
Olfr325 T A 11: 58,581,382 H179Q probably benign Het
Olfr584 T A 7: 103,086,263 C243* probably null Het
Olfr682-ps1 A G 7: 105,128,252 Y52H probably damaging Het
P2rx7 A T 5: 122,673,373 I331F probably benign Het
Pcdhb14 A T 18: 37,448,884 T348S possibly damaging Het
Prdx6b A G 2: 80,293,402 E185G probably benign Het
Rdh1 A G 10: 127,764,707 K200E possibly damaging Het
Sema6c A T 3: 95,173,199 R935W probably damaging Het
Serpinb5 A T 1: 106,875,142 I136F probably damaging Het
Skint10 A T 4: 112,765,092 Y31* probably null Het
St6galnac1 C T 11: 116,766,072 probably null Het
Synj1 G A 16: 90,961,499 T819M probably damaging Het
Tacr3 T A 3: 134,929,908 V291E probably damaging Het
Tdo2 A G 3: 81,968,083 probably null Het
Tex15 T A 8: 33,546,263 D72E possibly damaging Het
Tph2 T C 10: 115,079,822 T438A probably benign Het
Uaca A G 9: 60,869,905 T525A probably benign Het
Ulk1 A T 5: 110,792,404 C384S probably benign Het
Uvrag T C 7: 98,991,963 D290G probably benign Het
Zfp541 T C 7: 16,071,994 L18P probably damaging Het
Other mutations in Adarb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Adarb2 APN 13 8701725 missense probably benign 0.00
IGL00910:Adarb2 APN 13 8672433 missense probably damaging 1.00
IGL01308:Adarb2 APN 13 8203293 missense possibly damaging 0.93
IGL01337:Adarb2 APN 13 8570246 missense probably benign 0.03
IGL01508:Adarb2 APN 13 8752570 splice site probably null
IGL01792:Adarb2 APN 13 8570149 missense probably damaging 1.00
IGL02387:Adarb2 APN 13 8569958 missense probably damaging 1.00
IGL02423:Adarb2 APN 13 8569720 missense probably damaging 0.99
R0304:Adarb2 UTSW 13 8752570 splice site probably benign
R0463:Adarb2 UTSW 13 8203188 start gained probably benign
R0646:Adarb2 UTSW 13 8731819 missense probably damaging 1.00
R0963:Adarb2 UTSW 13 8672415 missense probably damaging 1.00
R1066:Adarb2 UTSW 13 8757323 missense probably benign 0.14
R1451:Adarb2 UTSW 13 8339621 intron probably benign
R1656:Adarb2 UTSW 13 8203251 missense unknown
R1939:Adarb2 UTSW 13 8203322 critical splice donor site probably null
R2212:Adarb2 UTSW 13 8752618 missense probably damaging 1.00
R2484:Adarb2 UTSW 13 8569774 nonsense probably null
R2993:Adarb2 UTSW 13 8713716 missense probably benign 0.02
R3157:Adarb2 UTSW 13 8697633 missense probably benign 0.20
R3177:Adarb2 UTSW 13 8752627 missense probably damaging 1.00
R3277:Adarb2 UTSW 13 8752627 missense probably damaging 1.00
R3412:Adarb2 UTSW 13 8752618 missense probably damaging 1.00
R3949:Adarb2 UTSW 13 8570419 missense probably damaging 0.97
R4505:Adarb2 UTSW 13 8697691 missense probably damaging 1.00
R5232:Adarb2 UTSW 13 8713640 missense possibly damaging 0.80
R5831:Adarb2 UTSW 13 8559133 missense probably benign 0.45
R7113:Adarb2 UTSW 13 8731845 missense probably damaging 0.99
R7252:Adarb2 UTSW 13 8570180 missense probably benign 0.00
R7259:Adarb2 UTSW 13 8570252 missense probably benign
R7346:Adarb2 UTSW 13 8570384 missense probably damaging 1.00
R7422:Adarb2 UTSW 13 8757277 missense possibly damaging 0.83
R7733:Adarb2 UTSW 13 8752608 missense possibly damaging 0.82
R7749:Adarb2 UTSW 13 8569739 missense possibly damaging 0.96
R8683:Adarb2 UTSW 13 8757359 missense probably damaging 1.00
R8746:Adarb2 UTSW 13 8752644 missense probably benign 0.00
Z1177:Adarb2 UTSW 13 8570200 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGAAATGGCCCTGAAGTCC -3'
(R):5'- CAGCCATGACAAAGCTCTTGAC -3'

Sequencing Primer
(F):5'- AAATGGCCCTGAAGTCCTTTGTG -3'
(R):5'- CATGACAAAGCTCTTGACTCGGG -3'
Posted On2019-11-12