Incidental Mutation 'R7724:Uaca'
ID595402
Institutional Source Beutler Lab
Gene Symbol Uaca
Ensembl Gene ENSMUSG00000034485
Gene Nameuveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms2700059D02Rik, nucling
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7724 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location60794542-60880370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60869905 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 525 (T525A)
Ref Sequence ENSEMBL: ENSMUSP00000062047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050183] [ENSMUST00000214354]
Predicted Effect probably benign
Transcript: ENSMUST00000050183
AA Change: T525A

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000062047
Gene: ENSMUSG00000034485
AA Change: T525A

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
ANK 35 68 2.66e3 SMART
ANK 69 98 1.96e-3 SMART
ANK 102 131 1.65e-1 SMART
ANK 135 164 1.38e-3 SMART
ANK 168 197 3.65e-3 SMART
ANK 201 230 6.26e-2 SMART
Blast:ANK 234 263 7e-9 BLAST
coiled coil region 301 381 N/A INTRINSIC
coiled coil region 445 626 N/A INTRINSIC
Pfam:TolA_bind_tri 869 943 4e-11 PFAM
coiled coil region 1009 1382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214354
AA Change: T523A

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice display swelling of and inflammatory lesions in the preputial gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,250 N148D possibly damaging Het
9130401M01Rik A C 15: 58,022,461 S342A probably benign Het
Adarb2 C A 13: 8,570,256 H259Q probably benign Het
Ak7 T A 12: 105,716,030 I150N probably damaging Het
Arhgef12 A T 9: 43,027,271 I75N probably damaging Het
Arhgef17 C T 7: 100,880,609 G480S probably damaging Het
Atic T C 1: 71,564,901 Y208H probably damaging Het
Atp8b4 T A 2: 126,322,893 N1168Y possibly damaging Het
Cdh15 G T 8: 122,866,961 D765Y probably damaging Het
Celf4 C T 18: 25,486,793 probably null Het
Cep57l1 G A 10: 41,745,842 T26M possibly damaging Het
Ces2g T A 8: 104,966,852 D388E probably benign Het
Cir1 T C 2: 73,306,890 N69S possibly damaging Het
Ctc1 C A 11: 69,026,344 H355N probably benign Het
Ebf2 A T 14: 67,424,040 K539M probably damaging Het
Ehbp1 G A 11: 22,089,572 H843Y probably null Het
Fat2 C T 11: 55,284,796 G1697E probably damaging Het
Fga A G 3: 83,029,125 D76G probably damaging Het
Fn1 A T 1: 71,603,735 S1786T probably benign Het
Frmpd1 A T 4: 45,229,888 E18D probably damaging Het
Gbp8 A T 5: 105,031,294 I113N probably damaging Het
Gm10549 A T 18: 33,470,859 R132* probably null Het
Gmps T A 3: 63,985,653 D126E possibly damaging Het
Gria4 A G 9: 4,472,074 Y472H probably damaging Het
Helz2 T C 2: 181,231,996 Y2235C probably damaging Het
Hrnr A G 3: 93,323,016 N187S unknown Het
Ifit1bl1 T C 19: 34,594,005 K351E probably benign Het
Klhl23 A G 2: 69,824,712 T309A probably benign Het
Ldhal6b A G 17: 5,418,602 V19A probably benign Het
Lrrc59 C T 11: 94,643,344 R243C probably damaging Het
Magi3 A C 3: 104,015,927 I1158R probably benign Het
Mical2 T A 7: 112,323,626 Y613N probably damaging Het
Myoc T A 1: 162,639,827 probably null Het
Npas3 C A 12: 54,068,341 S682Y possibly damaging Het
Ogdh T C 11: 6,324,887 V172A probably benign Het
Olfr1076 A G 2: 86,508,605 T49A probably damaging Het
Olfr284 A T 15: 98,340,894 S32T possibly damaging Het
Olfr325 T A 11: 58,581,382 H179Q probably benign Het
Olfr584 T A 7: 103,086,263 C243* probably null Het
Olfr682-ps1 A G 7: 105,128,252 Y52H probably damaging Het
P2rx7 A T 5: 122,673,373 I331F probably benign Het
Pcdhb14 A T 18: 37,448,884 T348S possibly damaging Het
Prdx6b A G 2: 80,293,402 E185G probably benign Het
Rdh1 A G 10: 127,764,707 K200E possibly damaging Het
Sema6c A T 3: 95,173,199 R935W probably damaging Het
Serpinb5 A T 1: 106,875,142 I136F probably damaging Het
Skint10 A T 4: 112,765,092 Y31* probably null Het
St6galnac1 C T 11: 116,766,072 probably null Het
Synj1 G A 16: 90,961,499 T819M probably damaging Het
Tacr3 T A 3: 134,929,908 V291E probably damaging Het
Tdo2 A G 3: 81,968,083 probably null Het
Tex15 T A 8: 33,546,263 D72E possibly damaging Het
Tph2 T C 10: 115,079,822 T438A probably benign Het
Ulk1 A T 5: 110,792,404 C384S probably benign Het
Uvrag T C 7: 98,991,963 D290G probably benign Het
Zfp541 T C 7: 16,071,994 L18P probably damaging Het
Other mutations in Uaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Uaca APN 9 60872225 missense probably benign
IGL01751:Uaca APN 9 60869857 missense probably damaging 1.00
IGL02868:Uaca APN 9 60863637 missense probably damaging 1.00
IGL02977:Uaca APN 9 60866380 missense probably benign 0.00
IGL03037:Uaca APN 9 60840865 missense probably damaging 1.00
IGL03060:Uaca APN 9 60869866 missense probably damaging 1.00
IGL03083:Uaca APN 9 60863663 missense probably benign 0.28
IGL03266:Uaca APN 9 60863407 missense probably damaging 1.00
IGL03346:Uaca APN 9 60854318 missense probably damaging 1.00
Ixtapa UTSW 9 60870413 missense probably damaging 0.99
oaxaca UTSW 9 60871451 missense probably benign
R0408:Uaca UTSW 9 60871859 missense possibly damaging 0.71
R0567:Uaca UTSW 9 60871381 missense probably benign 0.01
R0598:Uaca UTSW 9 60870921 nonsense probably null
R0603:Uaca UTSW 9 60871097 missense possibly damaging 0.60
R0655:Uaca UTSW 9 60872029 missense probably benign 0.03
R0707:Uaca UTSW 9 60848618 splice site probably benign
R0791:Uaca UTSW 9 60872059 missense possibly damaging 0.50
R1466:Uaca UTSW 9 60854321 missense possibly damaging 0.88
R1466:Uaca UTSW 9 60854321 missense possibly damaging 0.88
R1520:Uaca UTSW 9 60871381 missense probably benign 0.30
R1673:Uaca UTSW 9 60872156 missense probably damaging 1.00
R1894:Uaca UTSW 9 60870436 missense possibly damaging 0.87
R1997:Uaca UTSW 9 60870341 missense probably damaging 1.00
R2042:Uaca UTSW 9 60869891 missense probably damaging 1.00
R2095:Uaca UTSW 9 60840843 missense probably benign 0.00
R2148:Uaca UTSW 9 60869679 missense probably damaging 1.00
R2384:Uaca UTSW 9 60869917 missense probably damaging 1.00
R3110:Uaca UTSW 9 60871499 missense probably damaging 1.00
R3112:Uaca UTSW 9 60871499 missense probably damaging 1.00
R4001:Uaca UTSW 9 60871084 missense probably benign 0.04
R4155:Uaca UTSW 9 60871753 missense probably benign 0.02
R4156:Uaca UTSW 9 60871753 missense probably benign 0.02
R4157:Uaca UTSW 9 60871753 missense probably benign 0.02
R4410:Uaca UTSW 9 60869891 missense probably damaging 1.00
R4674:Uaca UTSW 9 60854429 missense possibly damaging 0.94
R4871:Uaca UTSW 9 60846001 missense probably damaging 1.00
R5130:Uaca UTSW 9 60880228 missense probably damaging 0.96
R5328:Uaca UTSW 9 60870532 missense probably benign 0.44
R5358:Uaca UTSW 9 60871148 missense probably benign
R5415:Uaca UTSW 9 60870139 missense possibly damaging 0.65
R5437:Uaca UTSW 9 60871451 missense probably benign
R5647:Uaca UTSW 9 60872098 missense probably benign 0.28
R5710:Uaca UTSW 9 60871811 missense probably damaging 1.00
R5920:Uaca UTSW 9 60869603 missense probably benign 0.19
R5931:Uaca UTSW 9 60872012 missense probably damaging 0.97
R5933:Uaca UTSW 9 60840956 missense probably damaging 1.00
R5959:Uaca UTSW 9 60870770 missense probably damaging 1.00
R6193:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6195:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6242:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6243:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6244:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6274:Uaca UTSW 9 60850291 splice site probably null
R6670:Uaca UTSW 9 60872024 missense probably benign 0.09
R6883:Uaca UTSW 9 60869891 missense probably damaging 1.00
R7011:Uaca UTSW 9 60870368 missense probably damaging 1.00
R7111:Uaca UTSW 9 60871838 missense probably benign 0.06
R7146:Uaca UTSW 9 60870413 missense probably damaging 0.99
R7424:Uaca UTSW 9 60870110 missense probably damaging 1.00
R7485:Uaca UTSW 9 60846000 missense probably damaging 1.00
R7510:Uaca UTSW 9 60850205 splice site probably null
R7688:Uaca UTSW 9 60874127 missense probably benign 0.11
R7743:Uaca UTSW 9 60876395 missense probably damaging 0.99
X0067:Uaca UTSW 9 60859149 missense possibly damaging 0.69
Z1177:Uaca UTSW 9 60874123 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCCAAAACGAACTGGCTC -3'
(R):5'- GACTTCACATGTGCCGCATTC -3'

Sequencing Primer
(F):5'- AACTGGCTCACAAGGTGGC -3'
(R):5'- TTGAACTCTCCCACCAGCATC -3'
Posted On2019-11-12