Incidental Mutation 'R7764:Krt19'
ID 598136
Institutional Source Beutler Lab
Gene Symbol Krt19
Ensembl Gene ENSMUSG00000020911
Gene Name keratin 19
Synonyms cytokeratin 19, cytokeratin19, Krt-1.19, EndoC, K19, cytokeratin-19, Krt1-19
MMRRC Submission 045820-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7764 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 100031636-100036752 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100032218 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 282 (N282S)
Ref Sequence ENSEMBL: ENSMUSP00000007317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007317]
AlphaFold P19001
Predicted Effect probably benign
Transcript: ENSMUST00000007317
AA Change: N282S

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000007317
Gene: ENSMUSG00000020911
AA Change: N282S

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
low complexity region 38 70 N/A INTRINSIC
Filament 82 393 4.4e-173 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. Unlike its related family members, this smallest known acidic cytokeratin is not paired with a basic cytokeratin in epithelial cells. It is specifically expressed in the periderm, the transiently superficial layer that envelopes the developing epidermis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-in allele are viable. Mice homozygous for a reporter allele show partial and strain-dependent preweaning lethality but no anatomical or behavioral defects. Mice that are either homozygous or heterozygous for a targeted insertion into intron 6 exhibit sperm tail defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T G 16: 20,368,040 (GRCm39) L93V probably benign Het
Adss2 A C 1: 177,591,827 (GRCm39) M452R probably damaging Het
Aldh3b1 T A 19: 3,971,563 (GRCm39) K102* probably null Het
Ccdc162 A T 10: 41,566,109 (GRCm39) V78D possibly damaging Het
Ccr3 T C 9: 123,829,451 (GRCm39) V262A probably benign Het
Cdk13 A T 13: 17,895,890 (GRCm39) probably null Het
Cdyl A T 13: 36,000,126 (GRCm39) T136S possibly damaging Het
Chd2 T C 7: 73,121,567 (GRCm39) D1015G probably null Het
Cntn2 C A 1: 132,450,101 (GRCm39) A598S probably benign Het
Cxxc4 G T 3: 133,945,856 (GRCm39) G146C unknown Het
Dnah2 G A 11: 69,348,984 (GRCm39) T2501I probably benign Het
Dock8 T A 19: 25,074,899 (GRCm39) I471N probably benign Het
Eaf2 A G 16: 36,645,045 (GRCm39) V59A probably damaging Het
Egflam T A 15: 7,347,736 (GRCm39) I65F probably damaging Het
Exoc3l A G 8: 106,017,333 (GRCm39) V577A possibly damaging Het
Folh1 A T 7: 86,412,126 (GRCm39) M215K probably benign Het
Fosb T C 7: 19,038,971 (GRCm39) D271G possibly damaging Het
Frmd4b A G 6: 97,272,891 (GRCm39) Y834H probably damaging Het
Fsip2 T C 2: 82,811,252 (GRCm39) S2524P possibly damaging Het
Gbp3 A G 3: 142,271,024 (GRCm39) T143A probably benign Het
Grk2 A T 19: 4,337,391 (GRCm39) L632Q probably damaging Het
Hars1 A T 18: 36,903,237 (GRCm39) D364E probably damaging Het
Hsd17b4 G T 18: 50,279,482 (GRCm39) G154* probably null Het
Kif5c T C 2: 49,617,973 (GRCm39) probably null Het
Kif5c T C 2: 49,639,339 (GRCm39) L800P probably damaging Het
Med23 T G 10: 24,785,818 (GRCm39) probably null Het
Meltf A G 16: 31,699,085 (GRCm39) Q65R probably benign Het
Mms22l T C 4: 24,598,842 (GRCm39) S1106P probably damaging Het
Mprip A G 11: 59,655,242 (GRCm39) T733A probably damaging Het
Mul1 G A 4: 138,162,080 (GRCm39) G4S possibly damaging Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk G T 16: 34,742,553 (GRCm39) V1022L probably benign Het
Ncald G T 15: 37,397,454 (GRCm39) N75K probably damaging Het
Nfib A G 4: 82,238,731 (GRCm39) S492P possibly damaging Het
Notch2 A T 3: 98,050,304 (GRCm39) I1860F probably damaging Het
Or9i14 A G 19: 13,792,111 (GRCm39) I281T probably benign Het
Oxr1 T C 15: 41,683,263 (GRCm39) S298P probably benign Het
Pcnt T C 10: 76,190,082 (GRCm39) D2818G probably benign Het
Pmpcb G A 5: 21,948,450 (GRCm39) A244T probably damaging Het
Poln A G 5: 34,274,151 (GRCm39) probably null Het
Polr1a G A 6: 71,930,054 (GRCm39) V914M probably damaging Het
Rab15 A C 12: 76,851,215 (GRCm39) probably null Het
Rasgrf1 G T 9: 89,876,747 (GRCm39) S704I possibly damaging Het
Rsf1 GGCGGCGG GGCGGCGGGCGCGGCGG 7: 97,229,134 (GRCm39) probably benign Het
Sart1 C A 19: 5,438,613 (GRCm39) G15W probably damaging Het
Scrib T C 15: 75,919,242 (GRCm39) *1666W probably null Het
Setd1b G C 5: 123,284,622 (GRCm39) R184P unknown Het
Sfxn2 A T 19: 46,574,179 (GRCm39) N123I probably damaging Het
Slc22a3 A G 17: 12,677,383 (GRCm39) W262R probably damaging Het
Slc38a10 A G 11: 119,995,905 (GRCm39) L1064P probably damaging Het
Sorcs2 A T 5: 36,181,416 (GRCm39) S1077R possibly damaging Het
Them7 G T 2: 105,128,171 (GRCm39) E51* probably null Het
Ubc A G 5: 125,465,133 (GRCm39) S65P possibly damaging Het
Ubqln3 A T 7: 103,790,443 (GRCm39) M549K possibly damaging Het
Vmn1r222 A G 13: 23,416,529 (GRCm39) L228P probably damaging Het
Vmn2r60 A G 7: 41,844,535 (GRCm39) T633A probably damaging Het
Zfp382 T C 7: 29,832,700 (GRCm39) V117A probably benign Het
Zic1 C T 9: 91,247,745 (GRCm39) probably benign Het
Zmym4 A T 4: 126,819,409 (GRCm39) F165I probably benign Het
Other mutations in Krt19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02999:Krt19 APN 11 100,032,235 (GRCm39) splice site probably benign
R0755:Krt19 UTSW 11 100,032,965 (GRCm39) missense possibly damaging 0.87
R2226:Krt19 UTSW 11 100,032,401 (GRCm39) missense probably damaging 1.00
R2416:Krt19 UTSW 11 100,036,433 (GRCm39) missense probably benign
R4811:Krt19 UTSW 11 100,032,174 (GRCm39) missense possibly damaging 0.85
R8026:Krt19 UTSW 11 100,032,209 (GRCm39) missense probably damaging 0.99
R8669:Krt19 UTSW 11 100,031,993 (GRCm39) missense probably damaging 1.00
R8919:Krt19 UTSW 11 100,031,980 (GRCm39) missense probably damaging 1.00
R8952:Krt19 UTSW 11 100,031,768 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGAGGCAGGTTCCTGAACAC -3'
(R):5'- CCAAGATCCTGAGTGAGATGAG -3'

Sequencing Primer
(F):5'- TTCCTGAACACGGGCACAG -3'
(R):5'- GTCAGTATGAGATCATGGCCG -3'
Posted On 2019-11-26