Incidental Mutation 'R7764:Hars'
ID 598151
Institutional Source Beutler Lab
Gene Symbol Hars
Ensembl Gene ENSMUSG00000001380
Gene Name histidyl-tRNA synthetase
Synonyms MMHRS
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock # R7764 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 36766530-36783205 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36770184 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 364 (D364E)
Ref Sequence ENSEMBL: ENSMUSP00000001416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001416] [ENSMUST00000061522]
AlphaFold Q61035
Predicted Effect probably damaging
Transcript: ENSMUST00000001416
AA Change: D364E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001416
Gene: ENSMUSG00000001380
AA Change: D364E

DomainStartEndE-ValueType
WHEP-TRS 7 60 5.37e-11 SMART
Pfam:tRNA-synt_His 61 389 1.9e-41 PFAM
Pfam:HGTP_anticodon2 404 507 3.3e-12 PFAM
Pfam:HGTP_anticodon 410 501 4.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061522
SMART Domains Protein: ENSMUSP00000054412
Gene: ENSMUSG00000044595

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
RRM 59 132 2.49e-10 SMART
RRM 139 214 3.01e-1 SMART
Pfam:DND1_DSRM 253 333 1.1e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a cytoplasmic enzyme which belongs to the class II family of aminoacyl-tRNA synthetases. The enzyme is responsible for the synthesis of histidyl-transfer RNA, which is essential for the incorporation of histidine into proteins. The gene is located in a head-to-head orientation with HARSL on chromosome five, where the homologous genes share a bidirectional promoter. The gene product is a frequent target of autoantibodies in the human autoimmune disease polymyositis/dermatomyositis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T G 16: 20,549,290 L93V probably benign Het
Adss A C 1: 177,764,261 M452R probably damaging Het
Aldh3b1 T A 19: 3,921,563 K102* probably null Het
Ccdc162 A T 10: 41,690,113 V78D possibly damaging Het
Ccr3 T C 9: 124,029,414 V262A probably benign Het
Cdk13 A T 13: 17,721,305 probably null Het
Cdyl A T 13: 35,816,143 T136S possibly damaging Het
Chd2 T C 7: 73,471,819 D1015G probably null Het
Cntn2 C A 1: 132,522,363 A598S probably benign Het
Cxxc4 G T 3: 134,240,095 G146C unknown Het
Dnah2 G A 11: 69,458,158 T2501I probably benign Het
Dock8 T A 19: 25,097,535 I471N probably benign Het
Eaf2 A G 16: 36,824,683 V59A probably damaging Het
Egflam T A 15: 7,318,255 I65F probably damaging Het
Exoc3l A G 8: 105,290,701 V577A possibly damaging Het
Folh1 A T 7: 86,762,918 M215K probably benign Het
Fosb T C 7: 19,305,046 D271G possibly damaging Het
Frmd4b A G 6: 97,295,930 Y834H probably damaging Het
Fsip2 T C 2: 82,980,908 S2524P possibly damaging Het
Gbp3 A G 3: 142,565,263 T143A probably benign Het
Grk2 A T 19: 4,287,363 L632Q probably damaging Het
Hsd17b4 G T 18: 50,146,415 G154* probably null Het
Kif5c T C 2: 49,727,961 probably null Het
Kif5c T C 2: 49,749,327 L800P probably damaging Het
Krt19 T C 11: 100,141,392 N282S probably benign Het
Med23 T G 10: 24,909,920 probably null Het
Meltf A G 16: 31,880,267 Q65R probably benign Het
Mms22l T C 4: 24,598,842 S1106P probably damaging Het
Mprip A G 11: 59,764,416 T733A probably damaging Het
Mul1 G A 4: 138,434,769 G4S possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk G T 16: 34,922,183 V1022L probably benign Het
Ncald G T 15: 37,397,210 N75K probably damaging Het
Nfib A G 4: 82,320,494 S492P possibly damaging Het
Notch2 A T 3: 98,142,988 I1860F probably damaging Het
Olfr1499 A G 19: 13,814,747 I281T probably benign Het
Oxr1 T C 15: 41,819,867 S298P probably benign Het
Pcnt T C 10: 76,354,248 D2818G probably benign Het
Pmpcb G A 5: 21,743,452 A244T probably damaging Het
Poln A G 5: 34,116,807 probably null Het
Polr1a G A 6: 71,953,070 V914M probably damaging Het
Rab15 A C 12: 76,804,441 probably null Het
Rasgrf1 G T 9: 89,994,694 S704I possibly damaging Het
Rsf1 GGCGGCGG GGCGGCGGGCGCGGCGG 7: 97,579,927 probably benign Het
Sart1 C A 19: 5,388,585 G15W probably damaging Het
Scrib T C 15: 76,047,393 *1666W probably null Het
Setd1b G C 5: 123,146,559 R184P unknown Het
Sfxn2 A T 19: 46,585,740 N123I probably damaging Het
Slc22a3 A G 17: 12,458,496 W262R probably damaging Het
Slc38a10 A G 11: 120,105,079 L1064P probably damaging Het
Sorcs2 A T 5: 36,024,072 S1077R possibly damaging Het
Them7 G T 2: 105,297,826 E51* probably null Het
Ubc A G 5: 125,388,069 S65P possibly damaging Het
Ubqln3 A T 7: 104,141,236 M549K possibly damaging Het
Vmn1r222 A G 13: 23,232,359 L228P probably damaging Het
Vmn2r60 A G 7: 42,195,111 T633A probably damaging Het
Zfp382 T C 7: 30,133,275 V117A probably benign Het
Zic1 C T 9: 91,365,692 probably benign Het
Zmym4 A T 4: 126,925,616 F165I probably benign Het
Other mutations in Hars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Hars APN 18 36768172 missense probably damaging 1.00
IGL01993:Hars APN 18 36770212 missense probably damaging 1.00
IGL03079:Hars APN 18 36770503 missense probably damaging 1.00
P0040:Hars UTSW 18 36773575 missense probably damaging 0.99
R0542:Hars UTSW 18 36771181 missense probably benign 0.23
R0630:Hars UTSW 18 36771389 missense probably damaging 1.00
R1171:Hars UTSW 18 36771414 missense possibly damaging 0.81
R1711:Hars UTSW 18 36771103 missense probably damaging 1.00
R1744:Hars UTSW 18 36770832 missense probably benign 0.00
R1873:Hars UTSW 18 36767241 missense probably damaging 0.99
R3907:Hars UTSW 18 36782716 missense probably benign 0.00
R5193:Hars UTSW 18 36767305 missense possibly damaging 0.94
R5688:Hars UTSW 18 36772316 missense probably damaging 1.00
R6331:Hars UTSW 18 36771332 missense probably benign 0.19
R6349:Hars UTSW 18 36783054 missense probably benign 0.00
R6416:Hars UTSW 18 36773590 missense possibly damaging 0.95
R7075:Hars UTSW 18 36772355 missense possibly damaging 0.87
R7209:Hars UTSW 18 36773540 missense probably benign 0.14
R7409:Hars UTSW 18 36770113 missense probably damaging 1.00
R7538:Hars UTSW 18 36771141 missense probably benign 0.00
R7621:Hars UTSW 18 36770423 missense probably benign
R8401:Hars UTSW 18 36771190 missense possibly damaging 0.74
R8828:Hars UTSW 18 36766943 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCAGAGATGTTCCCTATCCAAAGC -3'
(R):5'- TGAAGTTGGAGATAGGAGCCCC -3'

Sequencing Primer
(F):5'- GATGTTCCCTATCCAAAGCAGTGC -3'
(R):5'- CAGCTGACCTCTGTGGCTTG -3'
Posted On 2019-11-26