Incidental Mutation 'R7764:Ccr3'
ID598130
Institutional Source Beutler Lab
Gene Symbol Ccr3
Ensembl Gene ENSMUSG00000035448
Gene Namechemokine (C-C motif) receptor 3
SynonymsCC-CKR3, MIP-1 alphaRL2, Cmkbr3, CKR3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7764 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location124021972-124031689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124029414 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 262 (V262A)
Ref Sequence ENSEMBL: ENSMUSP00000039107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039171]
Predicted Effect probably benign
Transcript: ENSMUST00000039171
AA Change: V262A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000039107
Gene: ENSMUSG00000035448
AA Change: V262A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 49 320 7.9e-9 PFAM
Pfam:7tm_1 55 305 2.8e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for C-C type chemokines. It belongs to family 1 of the G protein-coupled receptors. This receptor binds and responds to a variety of chemokines, including eotaxin (CCL11), eotaxin-3 (CCL26), MCP-3 (CCL7), MCP-4 (CCL13), and RANTES (CCL5). It is highly expressed in eosinophils and basophils, and is also detected in TH1 and TH2 cells, as well as in airway epithelial cells. This receptor may contribute to the accumulation and activation of eosinophils and other inflammatory cells in the allergic airway. It is also known to be an entry co-receptor for HIV-1. This gene and seven other chemokine receptor genes form a chemokine receptor gene cluster on the chromosomal region 3p21. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in impaired eosinophil trafficking to the lungs and small intestine, and in increased bronchorestriction following methacholine challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T G 16: 20,549,290 L93V probably benign Het
Adss A C 1: 177,764,261 M452R probably damaging Het
Aldh3b1 T A 19: 3,921,563 K102* probably null Het
Ccdc162 A T 10: 41,690,113 V78D possibly damaging Het
Cdk13 A T 13: 17,721,305 probably null Het
Cdyl A T 13: 35,816,143 T136S possibly damaging Het
Chd2 T C 7: 73,471,819 D1015G probably null Het
Cntn2 C A 1: 132,522,363 A598S probably benign Het
Cxxc4 G T 3: 134,240,095 G146C unknown Het
Dnah2 G A 11: 69,458,158 T2501I probably benign Het
Dock8 T A 19: 25,097,535 I471N probably benign Het
Eaf2 A G 16: 36,824,683 V59A probably damaging Het
Egflam T A 15: 7,318,255 I65F probably damaging Het
Exoc3l A G 8: 105,290,701 V577A possibly damaging Het
Folh1 A T 7: 86,762,918 M215K probably benign Het
Fosb T C 7: 19,305,046 D271G possibly damaging Het
Frmd4b A G 6: 97,295,930 Y834H probably damaging Het
Fsip2 T C 2: 82,980,908 S2524P possibly damaging Het
Gbp3 A G 3: 142,565,263 T143A probably benign Het
Grk2 A T 19: 4,287,363 L632Q probably damaging Het
Hars A T 18: 36,770,184 D364E probably damaging Het
Hsd17b4 G T 18: 50,146,415 G154* probably null Het
Kif5c T C 2: 49,727,961 probably null Het
Kif5c T C 2: 49,749,327 L800P probably damaging Het
Krt19 T C 11: 100,141,392 N282S probably benign Het
Med23 T G 10: 24,909,920 probably null Het
Meltf A G 16: 31,880,267 Q65R probably benign Het
Mms22l T C 4: 24,598,842 S1106P probably damaging Het
Mprip A G 11: 59,764,416 T733A probably damaging Het
Mul1 G A 4: 138,434,769 G4S possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk G T 16: 34,922,183 V1022L probably benign Het
Ncald G T 15: 37,397,210 N75K probably damaging Het
Nfib A G 4: 82,320,494 S492P possibly damaging Het
Notch2 A T 3: 98,142,988 I1860F probably damaging Het
Olfr1499 A G 19: 13,814,747 I281T probably benign Het
Oxr1 T C 15: 41,819,867 S298P probably benign Het
Pcnt T C 10: 76,354,248 D2818G probably benign Het
Pmpcb G A 5: 21,743,452 A244T probably damaging Het
Poln A G 5: 34,116,807 probably null Het
Polr1a G A 6: 71,953,070 V914M probably damaging Het
Rab15 A C 12: 76,804,441 probably null Het
Rasgrf1 G T 9: 89,994,694 S704I possibly damaging Het
Rsf1 GGCGGCGG GGCGGCGGGCGCGGCGG 7: 97,579,927 probably benign Het
Sart1 C A 19: 5,388,585 G15W probably damaging Het
Scrib T C 15: 76,047,393 *1666W probably null Het
Setd1b G C 5: 123,146,559 R184P unknown Het
Sfxn2 A T 19: 46,585,740 N123I probably damaging Het
Slc22a3 A G 17: 12,458,496 W262R probably damaging Het
Slc38a10 A G 11: 120,105,079 L1064P probably damaging Het
Sorcs2 A T 5: 36,024,072 S1077R possibly damaging Het
Them7 G T 2: 105,297,826 E51* probably null Het
Ubc A G 5: 125,388,069 S65P possibly damaging Het
Ubqln3 A T 7: 104,141,236 M549K possibly damaging Het
Vmn1r222 A G 13: 23,232,359 L228P probably damaging Het
Vmn2r60 A G 7: 42,195,111 T633A probably damaging Het
Zfp382 T C 7: 30,133,275 V117A probably benign Het
Zic1 C T 9: 91,365,692 probably benign Het
Zmym4 A T 4: 126,925,616 F165I probably benign Het
Other mutations in Ccr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Ccr3 APN 9 124029552 missense probably damaging 1.00
IGL03388:Ccr3 APN 9 124028621 splice site probably benign
PIT4810001:Ccr3 UTSW 9 124029608 missense probably benign 0.00
R0077:Ccr3 UTSW 9 124029024 missense probably damaging 1.00
R0118:Ccr3 UTSW 9 124029610 nonsense probably null
R0504:Ccr3 UTSW 9 124029441 missense possibly damaging 0.69
R0576:Ccr3 UTSW 9 124029009 missense probably damaging 1.00
R0606:Ccr3 UTSW 9 124028802 missense probably benign 0.07
R2108:Ccr3 UTSW 9 124029299 missense possibly damaging 0.88
R3826:Ccr3 UTSW 9 124029677 missense possibly damaging 0.95
R4583:Ccr3 UTSW 9 124029440 missense probably benign 0.03
R4807:Ccr3 UTSW 9 124029297 missense probably damaging 1.00
R4823:Ccr3 UTSW 9 124028681 missense probably damaging 1.00
R4824:Ccr3 UTSW 9 124028772 missense probably damaging 1.00
R4932:Ccr3 UTSW 9 124029006 missense probably damaging 1.00
R5108:Ccr3 UTSW 9 124028931 missense probably benign 0.05
R5590:Ccr3 UTSW 9 124028793 missense probably damaging 1.00
R5610:Ccr3 UTSW 9 124029481 missense probably damaging 1.00
R5981:Ccr3 UTSW 9 124028783 missense probably damaging 0.99
R7780:Ccr3 UTSW 9 124028952 missense probably benign
R8035:Ccr3 UTSW 9 124028975 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAAGACAGCTGGAAACGTTTC -3'
(R):5'- CCAGGTAAACTGCCACATTTC -3'

Sequencing Primer
(F):5'- GAAACGTTTCCATGCTCTAAGAATG -3'
(R):5'- CATTTCTGTGGAAAAAGAGCCG -3'
Posted On2019-11-26