Incidental Mutation 'R7764:Ubc'
ID598116
Institutional Source Beutler Lab
Gene Symbol Ubc
Ensembl Gene ENSMUSG00000008348
Gene Nameubiquitin C
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7764 (G1)
Quality Score105.008
Status Not validated
Chromosome5
Chromosomal Location125385965-125390202 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125388069 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 65 (S65P)
Ref Sequence ENSEMBL: ENSMUSP00000114180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100700] [ENSMUST00000108707] [ENSMUST00000136312] [ENSMUST00000156249]
PDB Structure
Crystal structure of human AMSH-LP DUB domain in complex with Lys63-linked ubiquitin dimer [X-RAY DIFFRACTION]
Crystal structure of the mouse RAP80 UIMs in complex with Lys63-linked di-ubiquitin [X-RAY DIFFRACTION]
Crystal structure of the mouse TAB2-NZF in complex with Lys63-linked di-ubiquitin [X-RAY DIFFRACTION]
Crystal structure of the mouse TAB3-NZF in complex with Lys63-linked di-ubiquitin [X-RAY DIFFRACTION]
Crystal structure of GFP-Wrnip1 UBZ domain fusion protein in complex with ubiquitin [X-RAY DIFFRACTION]
Crystal structure of CYLD USP domain (C596A) in complex with Lys63-linked diubiquitin [X-RAY DIFFRACTION]
The crystal structure of the DUB domain of AMSH orthologue, Sst2 from S. pombe, in complex with lysine 63-linked diubiquitin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000100700
SMART Domains Protein: ENSMUSP00000098265
Gene: ENSMUSG00000072612

DomainStartEndE-ValueType
low complexity region 34 71 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 125 144 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108707
AA Change: S65P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104347
Gene: ENSMUSG00000008348
AA Change: S65P

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
UBQ 77 148 2.14e-36 SMART
UBQ 153 201 1.42e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000136312
AA Change: S65P

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114180
Gene: ENSMUSG00000008348
AA Change: S65P

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
UBQ 77 148 2.14e-36 SMART
UBQ 153 224 2.14e-36 SMART
UBQ 229 300 2.14e-36 SMART
UBQ 305 376 2.14e-36 SMART
UBQ 381 452 2.14e-36 SMART
UBQ 457 528 2.14e-36 SMART
UBQ 533 604 2.14e-36 SMART
UBQ 609 680 2.14e-36 SMART
PDB:4MDK|H 684 711 9e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000156249
AA Change: S65P

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115578
Gene: ENSMUSG00000008348
AA Change: S65P

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
UBQ 77 148 2.14e-36 SMART
UBQ 153 224 2.14e-36 SMART
UBQ 229 300 2.14e-36 SMART
UBQ 305 376 2.14e-36 SMART
UBQ 381 452 2.14e-36 SMART
UBQ 457 528 2.14e-36 SMART
UBQ 533 604 2.14e-36 SMART
UBQ 609 680 2.14e-36 SMART
PDB:4MDK|H 684 711 9e-6 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a ubiquitin gene, ubiquitin C. The encoded protein is a polyubiquitin precursor. Conjugation of ubiquitin monomers or polymers can lead to various effects within a cell, depending on the residues to which ubiquitin is conjugated. Ubiquitination has been associated with protein degradation, DNA repair, cell cycle regulation, kinase modification, endocytosis, and regulation of other cell signaling pathways. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygous null embryos die between E 12.5 and E14.5 most likely due to a severe defect in liver cell proliferation. Mutant MEFs exhibit reduced growth rates, premature senescence, increased apoptosis and delayed cell-cycle progression, and are hypersensitive to proteasome inhibitors and heat shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T G 16: 20,549,290 L93V probably benign Het
Adss A C 1: 177,764,261 M452R probably damaging Het
Aldh3b1 T A 19: 3,921,563 K102* probably null Het
Ccdc162 A T 10: 41,690,113 V78D possibly damaging Het
Ccr3 T C 9: 124,029,414 V262A probably benign Het
Cdk13 A T 13: 17,721,305 probably null Het
Cdyl A T 13: 35,816,143 T136S possibly damaging Het
Chd2 T C 7: 73,471,819 D1015G probably null Het
Cntn2 C A 1: 132,522,363 A598S probably benign Het
Cxxc4 G T 3: 134,240,095 G146C unknown Het
Dnah2 G A 11: 69,458,158 T2501I probably benign Het
Dock8 T A 19: 25,097,535 I471N probably benign Het
Eaf2 A G 16: 36,824,683 V59A probably damaging Het
Egflam T A 15: 7,318,255 I65F probably damaging Het
Exoc3l A G 8: 105,290,701 V577A possibly damaging Het
Folh1 A T 7: 86,762,918 M215K probably benign Het
Fosb T C 7: 19,305,046 D271G possibly damaging Het
Frmd4b A G 6: 97,295,930 Y834H probably damaging Het
Fsip2 T C 2: 82,980,908 S2524P possibly damaging Het
Gbp3 A G 3: 142,565,263 T143A probably benign Het
Grk2 A T 19: 4,287,363 L632Q probably damaging Het
Hars A T 18: 36,770,184 D364E probably damaging Het
Hsd17b4 G T 18: 50,146,415 G154* probably null Het
Kif5c T C 2: 49,727,961 probably null Het
Kif5c T C 2: 49,749,327 L800P probably damaging Het
Krt19 T C 11: 100,141,392 N282S probably benign Het
Med23 T G 10: 24,909,920 probably null Het
Meltf A G 16: 31,880,267 Q65R probably benign Het
Mms22l T C 4: 24,598,842 S1106P probably damaging Het
Mprip A G 11: 59,764,416 T733A probably damaging Het
Mul1 G A 4: 138,434,769 G4S possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk G T 16: 34,922,183 V1022L probably benign Het
Ncald G T 15: 37,397,210 N75K probably damaging Het
Nfib A G 4: 82,320,494 S492P possibly damaging Het
Notch2 A T 3: 98,142,988 I1860F probably damaging Het
Olfr1499 A G 19: 13,814,747 I281T probably benign Het
Oxr1 T C 15: 41,819,867 S298P probably benign Het
Pcnt T C 10: 76,354,248 D2818G probably benign Het
Pmpcb G A 5: 21,743,452 A244T probably damaging Het
Poln A G 5: 34,116,807 probably null Het
Polr1a G A 6: 71,953,070 V914M probably damaging Het
Rab15 A C 12: 76,804,441 probably null Het
Rasgrf1 G T 9: 89,994,694 S704I possibly damaging Het
Rsf1 GGCGGCGG GGCGGCGGGCGCGGCGG 7: 97,579,927 probably benign Het
Sart1 C A 19: 5,388,585 G15W probably damaging Het
Scrib T C 15: 76,047,393 *1666W probably null Het
Setd1b G C 5: 123,146,559 R184P unknown Het
Sfxn2 A T 19: 46,585,740 N123I probably damaging Het
Slc22a3 A G 17: 12,458,496 W262R probably damaging Het
Slc38a10 A G 11: 120,105,079 L1064P probably damaging Het
Sorcs2 A T 5: 36,024,072 S1077R possibly damaging Het
Them7 G T 2: 105,297,826 E51* probably null Het
Ubqln3 A T 7: 104,141,236 M549K possibly damaging Het
Vmn1r222 A G 13: 23,232,359 L228P probably damaging Het
Vmn2r60 A G 7: 42,195,111 T633A probably damaging Het
Zfp382 T C 7: 30,133,275 V117A probably benign Het
Zic1 C T 9: 91,365,692 probably benign Het
Zmym4 A T 4: 126,925,616 F165I probably benign Het
Other mutations in Ubc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02225:Ubc APN 5 125386133 missense probably benign 0.08
IGL02430:Ubc APN 5 125387570 missense probably damaging 1.00
IGL02830:Ubc APN 5 125387313 missense probably damaging 0.97
IGL02866:Ubc APN 5 125387422 missense probably benign
IGL02902:Ubc APN 5 125386229 missense probably benign 0.15
IGL02927:Ubc APN 5 125386137 missense probably benign 0.01
IGL03027:Ubc APN 5 125387501 missense probably damaging 1.00
IGL03066:Ubc APN 5 125388263 splice site probably benign
R4940:Ubc UTSW 5 125386229 missense probably benign 0.15
R5509:Ubc UTSW 5 125387275 missense probably benign 0.30
R6318:Ubc UTSW 5 125388260 start codon destroyed probably null 0.99
R6339:Ubc UTSW 5 125387342 missense probably damaging 0.99
R7033:Ubc UTSW 5 125388174 missense probably damaging 1.00
R8097:Ubc UTSW 5 125389918 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTGCAAAGATCAGCCTC -3'
(R):5'- GTCATTCCTGACCTGTGAATTG -3'

Sequencing Primer
(F):5'- CTCTGCTGGTCAGGGGG -3'
(R):5'- TTTGTGACAGACGATGCAGATC -3'
Posted On2019-11-26