Incidental Mutation 'R7801:Zic4'
List |< first << previous [record 47 of 47]
ID600538
Institutional Source Beutler Lab
Gene Symbol Zic4
Ensembl Gene ENSMUSG00000036972
Gene Namezinc finger protein of the cerebellum 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location91362413-91389348 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 91384244 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 314 (A314S)
Ref Sequence ENSEMBL: ENSMUSP00000069568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066384] [ENSMUST00000172646] [ENSMUST00000173054] [ENSMUST00000173933]
Predicted Effect probably benign
Transcript: ENSMUST00000066384
AA Change: A314S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000069568
Gene: ENSMUSG00000036972
AA Change: A314S

DomainStartEndE-ValueType
ZnF_C2H2 135 169 4.74e1 SMART
ZnF_C2H2 178 205 7.68e0 SMART
ZnF_C2H2 211 235 8.02e-5 SMART
ZnF_C2H2 241 265 7.15e-2 SMART
ZnF_C2H2 271 295 3.21e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172646
AA Change: A307S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000134053
Gene: ENSMUSG00000036972
AA Change: A307S

DomainStartEndE-ValueType
ZnF_C2H2 128 162 4.74e1 SMART
ZnF_C2H2 171 198 7.68e0 SMART
ZnF_C2H2 204 228 8.02e-5 SMART
ZnF_C2H2 234 258 7.15e-2 SMART
ZnF_C2H2 264 288 3.21e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173054
SMART Domains Protein: ENSMUSP00000134364
Gene: ENSMUSG00000036972

DomainStartEndE-ValueType
PDB:2EJ4|A 122 181 3e-16 PDB
Blast:ZnF_C2H2 128 151 5e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173933
AA Change: A307S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000133958
Gene: ENSMUSG00000036972
AA Change: A307S

DomainStartEndE-ValueType
ZnF_C2H2 128 162 4.74e1 SMART
ZnF_C2H2 171 198 7.68e0 SMART
ZnF_C2H2 204 228 8.02e-5 SMART
ZnF_C2H2 234 258 7.15e-2 SMART
ZnF_C2H2 264 288 3.21e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development, and have been associated with X-linked visceral heterotaxy and holoprosencephaly type 5. This gene is closely linked to the gene encoding zinc finger protein of the cerebellum 1, a related family member on chromosome 3. Heterozygous deletion of these linked genes is involved in Dandy-Walker malformation, which is a congenital cerebellar malformation. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice heterozygous for a knock-out allele exhibit posterior cerebellar hypoplasia and a mild defect in anterior cerebellar foliation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Other mutations in Zic4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02423:Zic4 APN 9 91384175 missense probably damaging 1.00
PIT4418001:Zic4 UTSW 9 91379394 missense possibly damaging 0.91
R0628:Zic4 UTSW 9 91384117 nonsense probably null
R0628:Zic4 UTSW 9 91384119 missense probably benign 0.09
R1747:Zic4 UTSW 9 91384146 missense probably damaging 1.00
R2242:Zic4 UTSW 9 91378653 intron probably benign
R3917:Zic4 UTSW 9 91384341 splice site probably benign
R4021:Zic4 UTSW 9 91379036 missense probably benign 0.00
R4457:Zic4 UTSW 9 91379262 missense probably damaging 0.97
R4722:Zic4 UTSW 9 91379204 missense probably damaging 1.00
R5135:Zic4 UTSW 9 91384152 missense probably damaging 1.00
R5441:Zic4 UTSW 9 91384200 missense probably damaging 1.00
R5629:Zic4 UTSW 9 91378752 missense probably benign 0.36
R7179:Zic4 UTSW 9 91379121 missense possibly damaging 0.89
R7238:Zic4 UTSW 9 91379397 missense probably benign 0.38
R7914:Zic4 UTSW 9 91384128 missense probably damaging 1.00
X0018:Zic4 UTSW 9 91378803 missense probably damaging 1.00
Z1177:Zic4 UTSW 9 91378856 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAAGAAACATTCGCACGTG -3'
(R):5'- TAGACCGGCGTAAACCAGAG -3'

Sequencing Primer
(F):5'- CATTCGCACGTGCACAC -3'
(R):5'- AAGCAGCAGCCCTGATACTGG -3'
Posted On2019-11-26