Incidental Mutation 'R7829:Ubqln1'
ID602346
Institutional Source Beutler Lab
Gene Symbol Ubqln1
Ensembl Gene ENSMUSG00000005312
Gene Nameubiquilin 1
SynonymsXDRP1, Plic-1, Dsk2, DA41, D13Ertd372e, 1110046H03Rik, 1810030E05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.607) question?
Stock #R7829 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location58176156-58215653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58177905 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 546 (E546K)
Ref Sequence ENSEMBL: ENSMUSP00000075782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058735] [ENSMUST00000076454]
Predicted Effect probably damaging
Transcript: ENSMUST00000058735
AA Change: E574K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050191
Gene: ENSMUSG00000005312
AA Change: E574K

DomainStartEndE-ValueType
UBQ 28 98 7.78e-16 SMART
low complexity region 136 154 N/A INTRINSIC
STI1 173 201 6e0 SMART
STI1 203 242 6.75e-10 SMART
low complexity region 316 356 N/A INTRINSIC
STI1 381 428 2.62e-7 SMART
STI1 432 464 3.1e0 SMART
low complexity region 483 499 N/A INTRINSIC
UBA 540 578 1.77e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076454
AA Change: E546K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075782
Gene: ENSMUSG00000005312
AA Change: E546K

DomainStartEndE-ValueType
UBQ 28 98 7.78e-16 SMART
low complexity region 136 154 N/A INTRINSIC
STI1 173 201 6e0 SMART
STI1 203 242 6.75e-10 SMART
low complexity region 316 356 N/A INTRINSIC
STI1 381 420 2.24e-6 SMART
low complexity region 455 471 N/A INTRINSIC
UBA 512 550 1.77e-6 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and thus are thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This ubiquilin has also been shown to modulate accumulation of presenilin proteins, and it is found in lesions associated with Alzheimer's and Parkinson's disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null animals display impaired degradation of ubiquitinated proteins in the brain, increased ischemia/reperfusion-caused brain injury, and slower functional recovery after injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C G 11: 58,879,997 L102V not run Het
Abca12 A T 1: 71,292,421 S1323R probably benign Het
Abcb1a T A 5: 8,698,623 I318N probably benign Het
Adam10 A T 9: 70,766,927 K524* probably null Het
Adamts3 C T 5: 89,861,490 G105R probably damaging Het
Adcy7 T C 8: 88,315,759 I418T probably damaging Het
Alg9 T A 9: 50,788,171 F165L probably damaging Het
Anapc2 G T 2: 25,277,741 R440L probably damaging Het
Arhgef17 A T 7: 100,876,845 H1876Q probably benign Het
Armc2 G A 10: 41,926,860 R606C probably benign Het
Cd163 T C 6: 124,304,779 S14P probably benign Het
Cfap74 T C 4: 155,429,237 V502A Het
Copb2 T C 9: 98,588,094 I891T probably damaging Het
Creb3 T C 4: 43,566,322 L276P probably damaging Het
Crnkl1 T A 2: 145,931,349 M126L probably benign Het
Csrp2 C T 10: 110,935,184 A50V probably damaging Het
Ctsd A G 7: 142,377,142 C284R probably damaging Het
Dll3 G A 7: 28,294,650 A454V probably damaging Het
Dmbx1 C T 4: 115,923,907 probably benign Het
Dnah6 C A 6: 73,127,919 E1896* probably null Het
Dtwd1 A G 2: 126,164,759 T234A probably damaging Het
Fhod3 G A 18: 25,115,890 probably null Het
Gm10549 C A 18: 33,464,410 probably benign Het
Gm7298 T C 6: 121,765,338 I495T probably damaging Het
Grhl3 T C 4: 135,561,221 N51S probably damaging Het
Gtpbp4 A T 13: 8,985,330 probably null Het
Hsd17b14 A C 7: 45,566,785 S260R probably benign Het
Insig2 A T 1: 121,307,329 probably null Het
Itgae T A 11: 73,138,792 V1046D probably benign Het
Kif1b A T 4: 149,220,990 probably null Het
Kmo A G 1: 175,650,659 probably null Het
Loxhd1 A G 18: 77,408,787 N29S probably damaging Het
Lrp1b A T 2: 40,903,448 C2484* probably null Het
Lrrc23 T A 6: 124,770,748 M293L probably benign Het
Mphosph6 T C 8: 117,799,068 D47G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naglu G A 11: 101,076,610 R462H probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrc5 T C 8: 94,521,769 S1711P probably damaging Het
Olfr129 T C 17: 38,055,329 Y79C possibly damaging Het
Olfr420 A T 1: 174,158,859 I29F probably benign Het
Olfr97 T C 17: 37,232,310 E20G probably benign Het
Osbpl6 G A 2: 76,593,387 A857T probably damaging Het
Oscp1 C A 4: 126,088,408 D380E probably benign Het
Pdzd7 C A 19: 45,039,239 R265S probably benign Het
Piezo2 A T 18: 63,113,876 probably null Het
Pigc G A 1: 161,970,464 R5H probably benign Het
Pla2g5 C A 4: 138,804,534 R53L probably benign Het
Rbm6 T C 9: 107,852,706 R248G probably damaging Het
Rev1 A T 1: 38,056,445 L877Q probably damaging Het
Rpap3 A T 15: 97,681,708 N474K probably benign Het
Ryr2 T A 13: 11,827,607 E468V possibly damaging Het
Samd9l A C 6: 3,374,749 D837E probably benign Het
Sipa1l2 T C 8: 125,451,988 N1124S probably damaging Het
Slc11a2 G A 15: 100,409,261 A83V possibly damaging Het
Slfn14 A G 11: 83,281,817 probably null Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Suclg1 A G 6: 73,275,243 probably null Het
Syne1 A C 10: 5,342,293 V1325G probably damaging Het
Tmprss15 T C 16: 78,987,650 S706G probably benign Het
Tox2 T C 2: 163,320,376 Y389H probably damaging Het
Trappc10 T C 10: 78,199,075 T946A probably benign Het
Zfp106 A G 2: 120,524,057 V1411A possibly damaging Het
Zkscan5 A T 5: 145,218,703 K395* probably null Het
Other mutations in Ubqln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ubqln1 APN 13 58177992 nonsense probably null
IGL01566:Ubqln1 APN 13 58179667 splice site probably null
IGL02160:Ubqln1 APN 13 58192137 missense probably damaging 1.00
IGL03171:Ubqln1 APN 13 58180858 missense probably damaging 1.00
R0140:Ubqln1 UTSW 13 58193289 missense probably damaging 1.00
R1676:Ubqln1 UTSW 13 58179391 missense possibly damaging 0.67
R1712:Ubqln1 UTSW 13 58192081 missense probably damaging 1.00
R4400:Ubqln1 UTSW 13 58193388 missense probably damaging 1.00
R5194:Ubqln1 UTSW 13 58199033 missense probably benign
R5419:Ubqln1 UTSW 13 58183183 missense probably damaging 0.99
R5778:Ubqln1 UTSW 13 58183317 missense probably benign 0.00
R6198:Ubqln1 UTSW 13 58196590 missense probably benign
R8479:Ubqln1 UTSW 13 58191839 missense probably benign
R8523:Ubqln1 UTSW 13 58191755 missense probably benign 0.00
R8834:Ubqln1 UTSW 13 58183244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACTCTGCCTCCAGATAC -3'
(R):5'- CAAAGGTGACCTGGGTATAGC -3'

Sequencing Primer
(F):5'- GCCTCCAGATACTTCCTATTGG -3'
(R):5'- ACCTGGGTATAGTTTAGACCGGC -3'
Posted On2019-12-03