Incidental Mutation 'R5419:Ubqln1'
ID501044
Institutional Source Beutler Lab
Gene Symbol Ubqln1
Ensembl Gene ENSMUSG00000005312
Gene Nameubiquilin 1
SynonymsXDRP1, Plic-1, Dsk2, DA41, D13Ertd372e, 1110046H03Rik, 1810030E05Rik
MMRRC Submission 042987-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #R5419 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location58176156-58215653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58183183 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 410 (Q410R)
Ref Sequence ENSEMBL: ENSMUSP00000075782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058735] [ENSMUST00000076454]
Predicted Effect probably damaging
Transcript: ENSMUST00000058735
AA Change: Q410R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050191
Gene: ENSMUSG00000005312
AA Change: Q410R

DomainStartEndE-ValueType
UBQ 28 98 7.78e-16 SMART
low complexity region 136 154 N/A INTRINSIC
STI1 173 201 6e0 SMART
STI1 203 242 6.75e-10 SMART
low complexity region 316 356 N/A INTRINSIC
STI1 381 428 2.62e-7 SMART
STI1 432 464 3.1e0 SMART
low complexity region 483 499 N/A INTRINSIC
UBA 540 578 1.77e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076454
AA Change: Q410R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075782
Gene: ENSMUSG00000005312
AA Change: Q410R

DomainStartEndE-ValueType
UBQ 28 98 7.78e-16 SMART
low complexity region 136 154 N/A INTRINSIC
STI1 173 201 6e0 SMART
STI1 203 242 6.75e-10 SMART
low complexity region 316 356 N/A INTRINSIC
STI1 381 420 2.24e-6 SMART
low complexity region 455 471 N/A INTRINSIC
UBA 512 550 1.77e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224851
Predicted Effect unknown
Transcript: ENSMUST00000225645
AA Change: Q47R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225818
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and thus are thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This ubiquilin has also been shown to modulate accumulation of presenilin proteins, and it is found in lesions associated with Alzheimer's and Parkinson's disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null animals display impaired degradation of ubiquitinated proteins in the brain, increased ischemia/reperfusion-caused brain injury, and slower functional recovery after injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,272,090 L926* probably null Het
4931429L15Rik C T 9: 46,309,326 probably null Het
Abca13 T A 11: 9,193,533 probably null Het
AI481877 A T 4: 59,049,017 M1116K probably benign Het
Akap13 A T 7: 75,610,243 T69S probably benign Het
Arl1 T A 10: 88,737,104 C80S probably damaging Het
Brsk1 A G 7: 4,709,004 T618A possibly damaging Het
Cep295 T C 9: 15,324,237 H1982R probably damaging Het
Ces5a A T 8: 93,499,431 S559T unknown Het
Clcf1 A G 19: 4,222,159 N90S possibly damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Cobll1 A T 2: 65,103,357 D430E possibly damaging Het
Cyp1a2 T A 9: 57,682,511 I7F probably benign Het
Cyp2b23 G A 7: 26,681,423 R126* probably null Het
Daam2 A G 17: 49,480,754 W444R possibly damaging Het
Dcbld2 T A 16: 58,455,258 C446S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eif2d T C 1: 131,158,298 *177R probably null Het
Fkbp15 G A 4: 62,327,877 A438V probably damaging Het
Gjb5 G A 4: 127,355,859 A164V probably benign Het
Gm17727 T A 9: 35,778,111 probably null Het
Gm5724 C T 6: 141,736,100 probably null Het
Grin1 A T 2: 25,298,273 probably null Het
Grm3 A G 5: 9,570,233 F337S probably damaging Het
Hey2 T A 10: 30,834,023 T245S probably benign Het
Ifi206 T C 1: 173,481,231 T400A probably benign Het
Itga7 G A 10: 128,944,033 E480K probably null Het
Itpr1 T C 6: 108,493,794 Y2227H possibly damaging Het
Krt8 T C 15: 102,003,902 D113G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 A G 7: 66,708,095 probably benign Het
Lmf1 A T 17: 25,662,636 D553V possibly damaging Het
Lnpep A G 17: 17,566,730 S536P probably damaging Het
Lrp1b A T 2: 40,730,704 C3587* probably null Het
Macf1 A T 4: 123,397,124 D3435E possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Myg1 A T 15: 102,336,962 N206I probably damaging Het
Myl12a T G 17: 70,994,699 R144S probably benign Het
Myo5a T A 9: 75,147,897 I454K probably damaging Het
Nwd2 A G 5: 63,807,708 D1545G probably benign Het
Ogdhl T G 14: 32,339,224 D457E probably damaging Het
Olfr202 T A 16: 59,284,341 D52V probably damaging Het
Olfr466 A C 13: 65,152,774 L183F probably damaging Het
Paf1 A G 7: 28,395,670 I112V possibly damaging Het
Pcdhga4 C T 18: 37,686,745 P449L probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Ptgs1 A G 2: 36,237,222 Y40C probably damaging Het
Ptprn2 A T 12: 117,184,647 I676F probably damaging Het
Rev3l T C 10: 39,824,931 L1808P possibly damaging Het
Sall2 A G 14: 52,313,129 S868P probably damaging Het
Slc47a2 A G 11: 61,307,586 F428L probably benign Het
Slco3a1 A T 7: 74,284,615 F603Y possibly damaging Het
Smyd2 A T 1: 189,909,893 C65* probably null Het
Ssu72 T C 4: 155,715,550 F57L probably damaging Het
Tanc2 A G 11: 105,922,883 T1718A probably benign Het
Tnks G C 8: 34,965,566 P34A unknown Het
Top3a G A 11: 60,762,522 T42I probably damaging Het
Trank1 T C 9: 111,391,301 S2369P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r11 A G 5: 109,059,358 I32T possibly damaging Het
Xcr1 A G 9: 123,856,310 F129S probably benign Het
Other mutations in Ubqln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ubqln1 APN 13 58177992 nonsense probably null
IGL01566:Ubqln1 APN 13 58179667 splice site probably null
IGL02160:Ubqln1 APN 13 58192137 missense probably damaging 1.00
IGL03171:Ubqln1 APN 13 58180858 missense probably damaging 1.00
R0140:Ubqln1 UTSW 13 58193289 missense probably damaging 1.00
R1676:Ubqln1 UTSW 13 58179391 missense possibly damaging 0.67
R1712:Ubqln1 UTSW 13 58192081 missense probably damaging 1.00
R4400:Ubqln1 UTSW 13 58193388 missense probably damaging 1.00
R5194:Ubqln1 UTSW 13 58199033 missense probably benign
R5778:Ubqln1 UTSW 13 58183317 missense probably benign 0.00
R6198:Ubqln1 UTSW 13 58196590 missense probably benign
R7829:Ubqln1 UTSW 13 58177905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGATCAGAGCAGGTTCCC -3'
(R):5'- TGTGCCTTGGAGCCATAACC -3'

Sequencing Primer
(F):5'- GCAGGTTCCCTAAAAATGCCTGG -3'
(R):5'- GAGCTTAGTAACTAGTACTGGTTAGC -3'
Posted On2017-12-01