Incidental Mutation 'RF016:Ddb1'
Institutional Source Beutler Lab
Gene Symbol Ddb1
Ensembl Gene ENSMUSG00000024740
Gene Namedamage specific DNA binding protein 1
SynonymsDNA repair protein, p127-Ddb1, damage-specific DNA-binding protein, DNA repair
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF016 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location10605625-10629813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10627858 bp
Amino Acid Change Histidine to Arginine at position 1070 (H1070R)
Ref Sequence ENSEMBL: ENSMUSP00000025649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025649]
Predicted Effect probably damaging
Transcript: ENSMUST00000025649
AA Change: H1070R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025649
Gene: ENSMUSG00000024740
AA Change: H1070R

Pfam:MMS1_N 75 543 1.9e-122 PFAM
low complexity region 755 775 N/A INTRINSIC
Pfam:CPSF_A 788 1099 1e-92 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the large subunit (p127) of the heterodimeric DNA damage-binding (DDB) complex while another protein (p48) forms the small subunit. This protein complex functions in nucleotide-excision repair and binds to DNA following UV damage. Defective activity of this complex causes the repair defect in patients with xeroderma pigmentosum complementation group E (XPE) - an autosomal recessive disorder characterized by photosensitivity and early onset of carcinomas. However, it remains for mutation analysis to demonstrate whether the defect in XPE patients is in this gene or the gene encoding the small subunit. In addition, Best vitelliform mascular dystrophy is mapped to the same region as this gene on 11q, but no sequence alternations of this gene are demonstrated in Best disease patients. The protein encoded by this gene also functions as an adaptor molecule for the cullin 4 (CUL4) ubiquitin E3 ligase complex by facilitating the binding of substrates to this complex and the ubiquitination of proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Complete deletion of this gene results in embryonic lethality; conditional mutation causes increased apoptosis in the developing brain, and defects in lens formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TGCTGTGGC TGCTGTGGCGGCTGTGGC 1: 82,913,577 probably benign Het
Abi3bp GCCCACGACCC GCCCACGACCCACGACCC 16: 56,627,587 probably null Het
Amer3 A G 1: 34,587,120 I147V probably damaging Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,909 probably benign Het
Ankhd1 GCGGCG GCGGCGACGGCG 18: 36,560,910 probably benign Het
Ankzf1 G A 1: 75,195,833 R259H probably damaging Het
Apol9b T C 15: 77,735,514 V170A probably benign Het
Asb3 A G 11: 31,061,407 I267M possibly damaging Het
Baz2a A G 10: 128,125,316 E1636G probably benign Het
Birc6 G T 17: 74,689,324 V4513F probably damaging Het
Blm CCTCCTCC CCTCCTCCTCCTACTCCTCC 7: 80,512,926 probably null Het
Ccdc113 G A 8: 95,538,105 R81H probably benign Het
Ccdc27 T C 4: 154,036,110 R410G probably benign Het
Cdhr5 A G 7: 141,272,184 V435A possibly damaging Het
Cercam T C 2: 29,869,305 S15P unknown Het
Cntrl T C 2: 35,119,986 V224A probably benign Het
Comtd1 T A 14: 21,848,596 Q56L probably benign Het
Cul9 CCT CCTACT 17: 46,500,863 probably null Het
Cyb5r4 AGGGA AGGGATGGGACAGACCCACTGCCCCGGGA 9: 87,040,444 probably benign Het
Cyld T A 8: 88,705,441 Y22* probably null Het
Dbt T C 3: 116,539,714 Y278H probably damaging Het
Dek G T 13: 47,098,186 S248* probably null Het
Dixdc1 T C 9: 50,693,641 T300A probably benign Het
Dusp8 A T 7: 142,082,852 S334T probably benign Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,756 probably benign Het
Ehbp1 T C 11: 22,146,646 N306S probably benign Het
Fcer1a T C 1: 173,225,519 I37V possibly damaging Het
Fgfr2 G T 7: 130,177,680 Q639K probably benign Het
Gab3 CTT CTTATT X: 74,999,985 probably null Het
Gins4 T C 8: 23,232,610 M98V probably benign Het
Gm35339 A T 15: 76,355,972 I331F Het
Gm813 T A 16: 58,616,867 N26I probably damaging Het
Gm8369 GTGTGTGT GTGTGTGTTTGTGTGT 19: 11,511,754 probably null Het
Grik1 G A 16: 88,034,186 S232L Het
Gsg1l A G 7: 126,020,622 probably null Het
H13 G A 2: 152,669,669 E30K probably damaging Het
H2-DMb1 A T 17: 34,157,386 S160C probably damaging Het
Jag1 T A 2: 137,096,256 T275S probably benign Het
Klhdc2 T A 12: 69,303,886 I158K probably damaging Het
Krtap28-10 TCCC TCCCGCACCC 1: 83,042,123 probably benign Het
Lrp2 T A 2: 69,509,205 M1121L probably benign Het
M6pr C T 6: 122,315,165 A152V probably damaging Het
Mapkapk5 T C 5: 121,533,316 Y218C probably damaging Het
Mkrn1 C T 6: 39,419,991 V26I Het
Mro CA CAAACTCGGA 18: 73,869,964 probably null Het
Mrpl3 T C 9: 105,075,253 V303A probably benign Het
Nid2 GGCTAACACCGC GGC 14: 19,751,363 probably benign Het
Olfr212 G T 6: 116,516,043 A89S probably benign Het
Olfr964-ps1 A ATAGG 9: 39,686,754 probably null Het
Ovol1 A G 19: 5,553,612 V87A probably benign Het
Pdpk1 T A 17: 24,093,281 E290D probably benign Het
Pkd1l3 T A 8: 109,623,542 S340T probably benign Het
Pknox2 ACACACACACACACACTCAC ACAC 9: 36,909,609 probably benign Het
Pou3f1 GC GCGGCGCC 4: 124,657,809 probably benign Het
Prpf6 A G 2: 181,632,076 M338V probably benign Het
Psg28 G T 7: 18,422,922 L463I probably damaging Het
Ptprd T C 4: 76,128,655 D211G probably benign Het
Pus1 T C 5: 110,776,558 H160R not run Het
Ranbp17 T C 11: 33,329,511 T582A probably damaging Het
Rasa1 G A 13: 85,223,488 T878I possibly damaging Het
Rbm20 A G 19: 53,813,732 T224A probably benign Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Sh3bp4 T C 1: 89,145,022 S531P probably benign Het
Sh3pxd2b TGCCTG TGCCTGCGCCTG 11: 32,423,053 probably benign Het
Snrnp200 T C 2: 127,230,556 L1291P probably damaging Het
Sppl2a C T 2: 126,927,774 R54Q probably benign Het
Sulf2 A T 2: 166,082,603 L521Q probably benign Het
Supv3l1 C A 10: 62,437,508 V317F possibly damaging Het
Usp38 A G 8: 81,013,893 S182P probably benign Het
Vmn2r24 T C 6: 123,804,215 V460A probably benign Het
Zfp598 CAACCAC CAACCACAACCAC 17: 24,680,771 probably benign Het
Other mutations in Ddb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Ddb1 APN 19 10611664 missense possibly damaging 0.85
IGL00742:Ddb1 APN 19 10610760 missense probably benign
IGL01161:Ddb1 APN 19 10605707 start codon destroyed probably null 1.00
IGL01364:Ddb1 APN 19 10627660 critical splice donor site probably null
IGL01804:Ddb1 APN 19 10613018 missense probably damaging 1.00
IGL01812:Ddb1 APN 19 10613018 missense probably damaging 1.00
IGL02523:Ddb1 APN 19 10627632 missense probably damaging 1.00
IGL02609:Ddb1 APN 19 10622466 missense possibly damaging 0.93
IGL02664:Ddb1 APN 19 10607883 missense probably benign
IGL03033:Ddb1 APN 19 10625926 missense possibly damaging 0.59
IGL03092:Ddb1 APN 19 10612945 missense probably damaging 1.00
IGL03110:Ddb1 APN 19 10612945 missense probably damaging 1.00
IGL03256:Ddb1 APN 19 10621861 missense probably benign 0.01
Dubitable UTSW 19 10622499 critical splice donor site probably null
Indubitable UTSW 19 10607911 critical splice donor site probably null
Van_der_waals UTSW 19 10612916 missense probably benign 0.11
PIT4445001:Ddb1 UTSW 19 10625970 missense probably damaging 1.00
R0028:Ddb1 UTSW 19 10619246 missense probably damaging 1.00
R0589:Ddb1 UTSW 19 10621716 missense probably benign 0.02
R0893:Ddb1 UTSW 19 10612916 missense probably benign 0.11
R1374:Ddb1 UTSW 19 10608318 missense probably damaging 1.00
R1611:Ddb1 UTSW 19 10612888 missense probably damaging 1.00
R1611:Ddb1 UTSW 19 10626764 critical splice donor site probably null
R1661:Ddb1 UTSW 19 10629080 missense probably benign 0.00
R1835:Ddb1 UTSW 19 10626593 missense probably damaging 1.00
R2036:Ddb1 UTSW 19 10610822 splice site probably benign
R2094:Ddb1 UTSW 19 10612936 missense probably benign
R2142:Ddb1 UTSW 19 10619126 critical splice donor site probably null
R2213:Ddb1 UTSW 19 10608327 missense probably damaging 1.00
R2318:Ddb1 UTSW 19 10626628 missense probably damaging 1.00
R2354:Ddb1 UTSW 19 10606973 missense probably benign 0.03
R3150:Ddb1 UTSW 19 10612982 missense probably benign 0.02
R3162:Ddb1 UTSW 19 10625971 missense probably damaging 0.99
R3162:Ddb1 UTSW 19 10625971 missense probably damaging 0.99
R3606:Ddb1 UTSW 19 10628493 missense probably damaging 1.00
R4050:Ddb1 UTSW 19 10627807 missense probably benign 0.00
R5157:Ddb1 UTSW 19 10622364 missense probably benign 0.01
R6244:Ddb1 UTSW 19 10625923 missense probably damaging 0.99
R6249:Ddb1 UTSW 19 10605720 nonsense probably null
R6812:Ddb1 UTSW 19 10622499 critical splice donor site probably null
R7337:Ddb1 UTSW 19 10627831 missense possibly damaging 0.88
R7460:Ddb1 UTSW 19 10607911 critical splice donor site probably null
R7737:Ddb1 UTSW 19 10625974 missense possibly damaging 0.93
R7903:Ddb1 UTSW 19 10608348 missense probably benign 0.12
R8288:Ddb1 UTSW 19 10608348 missense probably benign 0.12
R8376:Ddb1 UTSW 19 10619305 missense probably damaging 1.00
X0050:Ddb1 UTSW 19 10626659 missense possibly damaging 0.95
Z1088:Ddb1 UTSW 19 10619230 missense probably damaging 0.99
Z1177:Ddb1 UTSW 19 10608396 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04