Incidental Mutation 'R2036:Ddb1'
ID 224701
Institutional Source Beutler Lab
Gene Symbol Ddb1
Ensembl Gene ENSMUSG00000024740
Gene Name damage specific DNA binding protein 1
Synonyms damage-specific DNA-binding protein, DNA repair, p127-Ddb1, DNA repair protein
MMRRC Submission 040043-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2036 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 10582961-10607186 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 10588186 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025649]
AlphaFold Q3U1J4
Predicted Effect probably benign
Transcript: ENSMUST00000025649
SMART Domains Protein: ENSMUSP00000025649
Gene: ENSMUSG00000024740

DomainStartEndE-ValueType
Pfam:MMS1_N 75 543 1.9e-122 PFAM
low complexity region 755 775 N/A INTRINSIC
Pfam:CPSF_A 788 1099 1e-92 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the large subunit (p127) of the heterodimeric DNA damage-binding (DDB) complex while another protein (p48) forms the small subunit. This protein complex functions in nucleotide-excision repair and binds to DNA following UV damage. Defective activity of this complex causes the repair defect in patients with xeroderma pigmentosum complementation group E (XPE) - an autosomal recessive disorder characterized by photosensitivity and early onset of carcinomas. However, it remains for mutation analysis to demonstrate whether the defect in XPE patients is in this gene or the gene encoding the small subunit. In addition, Best vitelliform mascular dystrophy is mapped to the same region as this gene on 11q, but no sequence alternations of this gene are demonstrated in Best disease patients. The protein encoded by this gene also functions as an adaptor molecule for the cullin 4 (CUL4) ubiquitin E3 ligase complex by facilitating the binding of substrates to this complex and the ubiquitination of proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Complete deletion of this gene results in embryonic lethality; conditional mutation causes increased apoptosis in the developing brain, and defects in lens formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415H17Rik C T 11: 99,576,358 (GRCm39) C3Y unknown Het
Abr G T 11: 76,343,176 (GRCm39) T547K probably benign Het
Akr1c21 T C 13: 4,626,305 (GRCm39) Y110H probably damaging Het
Ankar T A 1: 72,705,689 (GRCm39) K556* probably null Het
Anks1b T C 10: 90,805,715 (GRCm39) V431A probably damaging Het
Ap5b1 T C 19: 5,618,897 (GRCm39) S106P possibly damaging Het
Arhgap17 T C 7: 122,917,717 (GRCm39) N156D possibly damaging Het
Arhgap35 T C 7: 16,297,058 (GRCm39) E669G probably damaging Het
Arhgap44 T C 11: 64,932,318 (GRCm39) M201V possibly damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Atg4c C T 4: 99,106,376 (GRCm39) T112M possibly damaging Het
Bcl11a A T 11: 24,114,087 (GRCm39) N477Y possibly damaging Het
Brinp3 A T 1: 146,577,579 (GRCm39) I205F possibly damaging Het
Capza2 T C 6: 17,660,777 (GRCm39) F159S probably damaging Het
Cd40 T C 2: 164,904,221 (GRCm39) C61R probably benign Het
Cdc25c G C 18: 34,871,292 (GRCm39) L275V probably damaging Het
Cdh23 A G 10: 60,301,822 (GRCm39) I415T possibly damaging Het
Clnk A T 5: 38,910,143 (GRCm39) probably null Het
Ctcfl C T 2: 172,943,778 (GRCm39) R524Q possibly damaging Het
Cyb5r4 T G 9: 86,924,932 (GRCm39) probably benign Het
Ddx51 C A 5: 110,804,491 (GRCm39) Q526K probably benign Het
Dennd6a A T 14: 26,329,274 (GRCm39) Q56L probably damaging Het
Dhdds T C 4: 133,698,410 (GRCm39) E142G probably damaging Het
Dnai1 A G 4: 41,632,225 (GRCm39) H553R probably damaging Het
Fryl T C 5: 73,179,887 (GRCm39) N2908S probably benign Het
Fryl C A 5: 73,265,305 (GRCm39) probably null Het
Fut9 A G 4: 25,620,322 (GRCm39) I164T probably damaging Het
Gba2 G A 4: 43,568,118 (GRCm39) probably benign Het
Gm11627 C T 11: 102,467,580 (GRCm39) V33I unknown Het
Helz2 T A 2: 180,879,272 (GRCm39) H782L probably benign Het
Kcnmb3 A G 3: 32,526,531 (GRCm39) V220A probably damaging Het
Kif20a T C 18: 34,761,515 (GRCm39) S303P possibly damaging Het
Kif22 A T 7: 126,630,126 (GRCm39) V470E possibly damaging Het
Majin C T 19: 6,263,342 (GRCm39) T132M probably benign Het
Mboat7 A G 7: 3,688,671 (GRCm39) probably null Het
Mkrn2 C A 6: 115,588,875 (GRCm39) P206Q probably benign Het
Mphosph9 G A 5: 124,442,274 (GRCm39) T358M probably damaging Het
Nkd1 A G 8: 89,318,305 (GRCm39) D210G probably damaging Het
Or4c110 C T 2: 88,831,976 (GRCm39) V219I probably damaging Het
Or4k41 T A 2: 111,279,971 (GRCm39) L162Q possibly damaging Het
Or5ae2 G T 7: 84,505,566 (GRCm39) probably benign Het
Or5b95 G C 19: 12,658,165 (GRCm39) G231A probably damaging Het
Or5p69 T A 7: 107,966,947 (GRCm39) N83K probably benign Het
Or6c35 G A 10: 129,169,541 (GRCm39) D264N probably benign Het
Or9s15 A T 1: 92,524,328 (GRCm39) E29V probably benign Het
Pi4ka A G 16: 17,120,976 (GRCm39) Y63H probably damaging Het
Plekha1 A G 7: 130,503,922 (GRCm39) R210G probably damaging Het
Ppp2r2c C T 5: 37,109,748 (GRCm39) T369I possibly damaging Het
Relch A G 1: 105,670,979 (GRCm39) D1029G probably damaging Het
Rmnd1 T C 10: 4,357,884 (GRCm39) D12G probably damaging Het
Rtn2 A G 7: 19,027,664 (GRCm39) K120E probably damaging Het
Sh3tc1 A G 5: 35,873,508 (GRCm39) S30P probably benign Het
Tln2 T C 9: 67,179,986 (GRCm39) E795G possibly damaging Het
Tmprss11d T A 5: 86,457,128 (GRCm39) Y177F probably damaging Het
Trrap C A 5: 144,765,372 (GRCm39) D2529E probably benign Het
Vmn2r58 A G 7: 41,513,417 (GRCm39) Y409H probably benign Het
Wdr72 T A 9: 74,058,876 (GRCm39) V323D probably damaging Het
Other mutations in Ddb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Ddb1 APN 19 10,589,028 (GRCm39) missense possibly damaging 0.85
IGL00742:Ddb1 APN 19 10,588,124 (GRCm39) missense probably benign
IGL01161:Ddb1 APN 19 10,583,071 (GRCm39) start codon destroyed probably null 1.00
IGL01364:Ddb1 APN 19 10,605,024 (GRCm39) critical splice donor site probably null
IGL01804:Ddb1 APN 19 10,590,382 (GRCm39) missense probably damaging 1.00
IGL01812:Ddb1 APN 19 10,590,382 (GRCm39) missense probably damaging 1.00
IGL02523:Ddb1 APN 19 10,604,996 (GRCm39) missense probably damaging 1.00
IGL02609:Ddb1 APN 19 10,599,830 (GRCm39) missense possibly damaging 0.93
IGL02664:Ddb1 APN 19 10,585,247 (GRCm39) missense probably benign
IGL03033:Ddb1 APN 19 10,603,290 (GRCm39) missense possibly damaging 0.59
IGL03092:Ddb1 APN 19 10,590,309 (GRCm39) missense probably damaging 1.00
IGL03110:Ddb1 APN 19 10,590,309 (GRCm39) missense probably damaging 1.00
IGL03256:Ddb1 APN 19 10,599,225 (GRCm39) missense probably benign 0.01
Dubitable UTSW 19 10,599,863 (GRCm39) critical splice donor site probably null
Indubitable UTSW 19 10,585,275 (GRCm39) critical splice donor site probably null
Van_der_waals UTSW 19 10,590,280 (GRCm39) missense probably benign 0.11
PIT4445001:Ddb1 UTSW 19 10,603,334 (GRCm39) missense probably damaging 1.00
R0028:Ddb1 UTSW 19 10,596,610 (GRCm39) missense probably damaging 1.00
R0589:Ddb1 UTSW 19 10,599,080 (GRCm39) missense probably benign 0.02
R0893:Ddb1 UTSW 19 10,590,280 (GRCm39) missense probably benign 0.11
R1374:Ddb1 UTSW 19 10,585,682 (GRCm39) missense probably damaging 1.00
R1611:Ddb1 UTSW 19 10,604,128 (GRCm39) critical splice donor site probably null
R1611:Ddb1 UTSW 19 10,590,252 (GRCm39) missense probably damaging 1.00
R1661:Ddb1 UTSW 19 10,606,444 (GRCm39) missense probably benign 0.00
R1835:Ddb1 UTSW 19 10,603,957 (GRCm39) missense probably damaging 1.00
R2094:Ddb1 UTSW 19 10,590,300 (GRCm39) missense probably benign
R2142:Ddb1 UTSW 19 10,596,490 (GRCm39) critical splice donor site probably null
R2213:Ddb1 UTSW 19 10,585,691 (GRCm39) missense probably damaging 1.00
R2318:Ddb1 UTSW 19 10,603,992 (GRCm39) missense probably damaging 1.00
R2354:Ddb1 UTSW 19 10,584,337 (GRCm39) missense probably benign 0.03
R3150:Ddb1 UTSW 19 10,590,346 (GRCm39) missense probably benign 0.02
R3162:Ddb1 UTSW 19 10,603,335 (GRCm39) missense probably damaging 0.99
R3162:Ddb1 UTSW 19 10,603,335 (GRCm39) missense probably damaging 0.99
R3606:Ddb1 UTSW 19 10,605,857 (GRCm39) missense probably damaging 1.00
R4050:Ddb1 UTSW 19 10,605,171 (GRCm39) missense probably benign 0.00
R5157:Ddb1 UTSW 19 10,599,728 (GRCm39) missense probably benign 0.01
R6244:Ddb1 UTSW 19 10,603,287 (GRCm39) missense probably damaging 0.99
R6249:Ddb1 UTSW 19 10,583,084 (GRCm39) nonsense probably null
R6812:Ddb1 UTSW 19 10,599,863 (GRCm39) critical splice donor site probably null
R7337:Ddb1 UTSW 19 10,605,195 (GRCm39) missense possibly damaging 0.88
R7460:Ddb1 UTSW 19 10,585,275 (GRCm39) critical splice donor site probably null
R7737:Ddb1 UTSW 19 10,603,338 (GRCm39) missense possibly damaging 0.93
R7903:Ddb1 UTSW 19 10,585,712 (GRCm39) missense probably benign 0.12
R8288:Ddb1 UTSW 19 10,585,712 (GRCm39) missense probably benign 0.12
R8376:Ddb1 UTSW 19 10,596,669 (GRCm39) missense probably damaging 1.00
R8970:Ddb1 UTSW 19 10,585,808 (GRCm39) missense probably benign 0.01
R9720:Ddb1 UTSW 19 10,585,724 (GRCm39) missense probably benign
RF016:Ddb1 UTSW 19 10,605,222 (GRCm39) missense probably damaging 1.00
X0050:Ddb1 UTSW 19 10,604,023 (GRCm39) missense possibly damaging 0.95
Z1088:Ddb1 UTSW 19 10,596,594 (GRCm39) missense probably damaging 0.99
Z1177:Ddb1 UTSW 19 10,585,760 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACAGGACCCCTACAGTTTGG -3'
(R):5'- GTTTTAGCTGTCGTGACTACAC -3'

Sequencing Primer
(F):5'- CCCTACAGTTTGGGGCAC -3'
(R):5'- TAGCTGTCGTGACTACACCTGAAG -3'
Posted On 2014-08-25