Incidental Mutation 'RF016:Ptprd'
ID603534
Institutional Source Beutler Lab
Gene Symbol Ptprd
Ensembl Gene ENSMUSG00000028399
Gene Nameprotein tyrosine phosphatase, receptor type, D
Synonyms1110002J03Rik, 3000002J10Rik, B230219D21Rik
Accession Numbers

Ncbi RefSeq: NM_001014288.2, NM_011211.2; MGI:97812

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF016 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location75941238-78211961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76128655 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 211 (D211G)
Ref Sequence ENSEMBL: ENSMUSP00000099898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050757] [ENSMUST00000098005] [ENSMUST00000102834] [ENSMUST00000107289] [ENSMUST00000173376] [ENSMUST00000174023] [ENSMUST00000174180] [ENSMUST00000174531] [ENSMUST00000174831] [ENSMUST00000174832]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050757
AA Change: D448G

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058466
Gene: ENSMUSG00000028399
AA Change: D448G

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 208 1.38e-15 SMART
IGc2 238 299 8.13e-4 SMART
FN3 313 392 7.92e-14 SMART
FN3 408 491 5.73e-11 SMART
IG_like 499 593 8.34e1 SMART
FN3 506 584 9.1e-14 SMART
FN3 597 674 1.21e0 SMART
transmembrane domain 847 869 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
PTPc 949 1207 6.38e-134 SMART
PTPc 1236 1498 9.17e-135 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098005
AA Change: D458G

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095614
Gene: ENSMUSG00000028399
AA Change: D458G

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 607 684 1.21e0 SMART
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 886 897 N/A INTRINSIC
PTPc 950 1208 6.38e-134 SMART
PTPc 1237 1499 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102834
AA Change: D211G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099898
Gene: ENSMUSG00000028399
AA Change: D211G

DomainStartEndE-ValueType
IGc2 1 62 8.13e-4 SMART
FN3 76 155 7.92e-14 SMART
FN3 171 254 5.73e-11 SMART
IG_like 262 356 8.34e1 SMART
FN3 269 347 9.1e-14 SMART
FN3 360 437 1.21e0 SMART
transmembrane domain 610 632 N/A INTRINSIC
low complexity region 633 645 N/A INTRINSIC
PTPc 698 956 6.38e-134 SMART
PTPc 985 1247 9.17e-135 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107289
AA Change: D458G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102910
Gene: ENSMUSG00000028399
AA Change: D458G

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 609 696 2.72e-12 SMART
FN3 712 809 2.87e-11 SMART
FN3 824 904 4.96e-6 SMART
FN3 919 1003 4.12e-12 SMART
FN3 1018 1095 1.95e0 SMART
transmembrane domain 1268 1290 N/A INTRINSIC
low complexity region 1291 1303 N/A INTRINSIC
PTPc 1356 1614 6.38e-134 SMART
PTPc 1643 1905 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173376
AA Change: D465G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000133468
Gene: ENSMUSG00000028399
AA Change: D465G

DomainStartEndE-ValueType
IGc2 43 112 8.57e-12 SMART
IGc2 145 221 8.5e-16 SMART
low complexity region 232 244 N/A INTRINSIC
IGc2 255 316 8.13e-4 SMART
FN3 330 409 7.92e-14 SMART
FN3 425 508 5.73e-11 SMART
IG_like 516 610 8.34e1 SMART
FN3 523 601 9.1e-14 SMART
FN3 614 691 1.21e0 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 887 899 N/A INTRINSIC
PTPc 952 1210 6.38e-134 SMART
PTPc 1239 1501 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174023
AA Change: D455G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000133562
Gene: ENSMUSG00000028399
AA Change: D455G

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 211 4.88e-16 SMART
low complexity region 222 234 N/A INTRINSIC
IGc2 245 306 8.13e-4 SMART
FN3 320 399 7.92e-14 SMART
FN3 415 498 5.73e-11 SMART
IG_like 506 600 8.34e1 SMART
FN3 513 591 9.1e-14 SMART
FN3 604 681 1.21e0 SMART
transmembrane domain 853 875 N/A INTRINSIC
low complexity region 882 893 N/A INTRINSIC
PTPc 946 1204 6.38e-134 SMART
PTPc 1233 1495 9.17e-135 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174180
AA Change: D445G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133973
Gene: ENSMUSG00000028399
AA Change: D445G

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 205 2.09e-15 SMART
IGc2 235 296 8.13e-4 SMART
FN3 310 389 7.92e-14 SMART
FN3 405 488 5.73e-11 SMART
IG_like 496 590 8.34e1 SMART
FN3 503 581 9.1e-14 SMART
FN3 596 683 2.72e-12 SMART
FN3 699 787 6.15e-11 SMART
FN3 802 882 4.96e-6 SMART
FN3 897 981 4.12e-12 SMART
FN3 996 1073 1.95e0 SMART
transmembrane domain 1246 1268 N/A INTRINSIC
low complexity region 1269 1281 N/A INTRINSIC
PTPc 1334 1592 6.38e-134 SMART
PTPc 1621 1883 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174531
AA Change: D452G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134229
Gene: ENSMUSG00000028399
AA Change: D452G

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 208 1.38e-15 SMART
low complexity region 219 231 N/A INTRINSIC
IGc2 242 303 8.13e-4 SMART
FN3 317 396 7.92e-14 SMART
FN3 412 495 5.73e-11 SMART
IG_like 503 597 8.34e1 SMART
FN3 510 588 9.1e-14 SMART
FN3 601 678 1.21e0 SMART
transmembrane domain 851 873 N/A INTRINSIC
low complexity region 874 886 N/A INTRINSIC
PTPc 939 1197 6.38e-134 SMART
PTPc 1226 1488 9.17e-135 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174831
AA Change: D458G

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133328
Gene: ENSMUSG00000028399
AA Change: D458G

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 607 684 1.21e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
PTPc 949 1207 6.38e-134 SMART
PTPc 1236 1498 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174832
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype Strain: 2158795
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired learning of spatial tasks, enhanced long-term potentiation at hippocampal synapses, and high mortality associated with reduced food intake. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(4) Gene trapped(5)
 

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TGCTGTGGC TGCTGTGGCGGCTGTGGC 1: 82,913,577 probably benign Het
Abi3bp GCCCACGACCC GCCCACGACCCACGACCC 16: 56,627,587 probably null Het
Amer3 A G 1: 34,587,120 I147V probably damaging Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,909 probably benign Het
Ankhd1 GCGGCG GCGGCGACGGCG 18: 36,560,910 probably benign Het
Ankzf1 G A 1: 75,195,833 R259H probably damaging Het
Apol9b T C 15: 77,735,514 V170A probably benign Het
Asb3 A G 11: 31,061,407 I267M possibly damaging Het
Baz2a A G 10: 128,125,316 E1636G probably benign Het
Birc6 G T 17: 74,689,324 V4513F probably damaging Het
Blm CCTCCTCC CCTCCTCCTCCTACTCCTCC 7: 80,512,926 probably null Het
Ccdc113 G A 8: 95,538,105 R81H probably benign Het
Ccdc27 T C 4: 154,036,110 R410G probably benign Het
Cdhr5 A G 7: 141,272,184 V435A possibly damaging Het
Cercam T C 2: 29,869,305 S15P unknown Het
Cntrl T C 2: 35,119,986 V224A probably benign Het
Comtd1 T A 14: 21,848,596 Q56L probably benign Het
Cul9 CCT CCTACT 17: 46,500,863 probably null Het
Cyb5r4 TGTGACAGACACACTGCCCAGGGA TGTGACAGACACACTGCCCAGGGACGTGACAGACACACTGCCCAGGGA 9: 87,040,425 probably benign Het
Cyb5r4 CCCAGGGA CCCAGGGATGTGACAGACACACTGACCAGGGA 9: 87,040,441 probably benign Het
Cyb5r4 AGGGA AGGGATGGGACAGACCCACTGCCCCGGGA 9: 87,040,444 probably benign Het
Cyld T A 8: 88,705,441 Y22* probably null Het
Dbt T C 3: 116,539,714 Y278H probably damaging Het
Ddb1 A G 19: 10,627,858 H1070R probably damaging Het
Dek G T 13: 47,098,186 S248* probably null Het
Dixdc1 T C 9: 50,693,641 T300A probably benign Het
Dusp8 A T 7: 142,082,852 S334T probably benign Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,756 probably benign Het
Ehbp1 T C 11: 22,146,646 N306S probably benign Het
Fcer1a T C 1: 173,225,519 I37V possibly damaging Het
Fgfr2 G T 7: 130,177,680 Q639K probably benign Het
Gab3 CTT CTTATT X: 74,999,985 probably null Het
Gins4 T C 8: 23,232,610 M98V probably benign Het
Gm35339 A T 15: 76,355,972 I331F Het
Gm813 T A 16: 58,616,867 N26I probably damaging Het
Gm8369 GTGTGTGT GTGTGTGTTTGTGTGT 19: 11,511,754 probably null Het
Grik1 G A 16: 88,034,186 S232L Het
Gsg1l A G 7: 126,020,622 probably null Het
H13 G A 2: 152,669,669 E30K probably damaging Het
H2-DMb1 A T 17: 34,157,386 S160C probably damaging Het
Hsdl2 GCAGCCACAGCTGCAG GCAGCCACAGCTGCAGCATCAGCCACAGCTGCAG 4: 59,610,643 probably benign Het
Iqcf4 TTTCCTTTTCCTTTT TTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTGTTCCTTTTCCTTTT 9: 106,570,609 probably benign Het
Jag1 T A 2: 137,096,256 T275S probably benign Het
Klhdc2 T A 12: 69,303,886 I158K probably damaging Het
Krtap28-10 TCCC TCCCGCACCC 1: 83,042,123 probably benign Het
Lrp2 T A 2: 69,509,205 M1121L probably benign Het
M6pr C T 6: 122,315,165 A152V probably damaging Het
Mapkapk5 T C 5: 121,533,316 Y218C probably damaging Het
Mkrn1 C T 6: 39,419,991 V26I Het
Mro CA CAAACTCGGA 18: 73,869,964 probably null Het
Mrpl3 T C 9: 105,075,253 V303A probably benign Het
Nefh CTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,022 probably benign Het
Nefh TCACCTGGGGACT TCACCTGGGGACTCGGCCCCACCTGGGGACT 11: 4,941,023 probably benign Het
Nid2 GGCTAACACCGC GGC 14: 19,751,363 probably benign Het
Nusap1 CAAGCTGAGA CAAGCTGAGATACACGTTAGCAGTGAGGAGAAAGCTGAGA 2: 119,627,601 probably benign Het
Olfr212 G T 6: 116,516,043 A89S probably benign Het
Olfr964-ps1 A ATAGG 9: 39,686,754 probably null Het
Ovol1 A G 19: 5,553,612 V87A probably benign Het
Pdpk1 T A 17: 24,093,281 E290D probably benign Het
Pkd1l3 T A 8: 109,623,542 S340T probably benign Het
Pknox2 ACACACACACACACACTCAC ACAC 9: 36,909,609 probably benign Het
Pou3f1 GC GCGGCGCC 4: 124,657,809 probably benign Het
Prp2 AGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGAGACCCCCTCAAGGCCCACCACC 6: 132,600,512 probably benign Het
Prpf6 A G 2: 181,632,076 M338V probably benign Het
Psg28 G T 7: 18,422,922 L463I probably damaging Het
Pus1 T C 5: 110,776,558 H160R not run Het
Ranbp17 T C 11: 33,329,511 T582A probably damaging Het
Rasa1 G A 13: 85,223,488 T878I possibly damaging Het
Rbm20 A G 19: 53,813,732 T224A probably benign Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Sh3bp4 T C 1: 89,145,022 S531P probably benign Het
Sh3pxd2b TGCCTG TGCCTGCGCCTG 11: 32,423,053 probably benign Het
Snrnp200 T C 2: 127,230,556 L1291P probably damaging Het
Sppl2a C T 2: 126,927,774 R54Q probably benign Het
Sulf2 A T 2: 166,082,603 L521Q probably benign Het
Supv3l1 C A 10: 62,437,508 V317F possibly damaging Het
Tcof1 TCC TCCACTTGGCTGCTGAGATGGGCACTTTCCCAGAGACCC 18: 60,833,575 probably benign Het
Thegl CTCCCCAGTCCCGCAAGGCCAG CTCCCCAGTCCCGCAAGGCCAGCGATCATCCCCAGTCCCGCAAGGCCAG 5: 77,016,408 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCCGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,289 probably benign Het
Unc13b CAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CAGAGCCAGAGCCAGAGCGAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,347 probably benign Het
Unc13b AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC AGCCAGAGCCAGAGCCAGCGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,350 probably benign Het
Usp38 A G 8: 81,013,893 S182P probably benign Het
Vmn2r24 T C 6: 123,804,215 V460A probably benign Het
Zfp598 CAACCAC CAACCACAACCAC 17: 24,680,771 probably benign Het
Other mutations in Ptprd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Ptprd APN 4 75998556 nonsense probably null
IGL01067:Ptprd APN 4 76059685 missense probably damaging 1.00
IGL01121:Ptprd APN 4 75954201 splice site probably benign
IGL01531:Ptprd APN 4 76085520 missense probably damaging 0.98
IGL01661:Ptprd APN 4 75954083 missense probably damaging 1.00
IGL01723:Ptprd APN 4 76243673 missense probably damaging 1.00
IGL01735:Ptprd APN 4 76136820 unclassified probably null
IGL01810:Ptprd APN 4 76140507 splice site probably benign
IGL01834:Ptprd APN 4 76128595 missense probably damaging 1.00
IGL01835:Ptprd APN 4 76246821 missense probably benign 0.02
IGL01867:Ptprd APN 4 76243647 missense probably damaging 1.00
IGL02582:Ptprd APN 4 75947124 missense probably damaging 1.00
IGL02591:Ptprd APN 4 75982050 missense probably damaging 1.00
IGL02741:Ptprd APN 4 76133284 missense probably damaging 1.00
IGL02866:Ptprd APN 4 76050437 missense probably damaging 1.00
IGL02960:Ptprd APN 4 76128868 missense probably damaging 1.00
IGL03155:Ptprd APN 4 76066219 missense possibly damaging 0.95
IGL03230:Ptprd APN 4 76050417 nonsense probably null
IGL03343:Ptprd APN 4 76059729 missense probably damaging 1.00
unhurried UTSW 4 76100633 nonsense probably null
ANU22:Ptprd UTSW 4 76100456 missense probably damaging 0.99
F5493:Ptprd UTSW 4 76084408 missense probably damaging 1.00
P0033:Ptprd UTSW 4 76128854 nonsense probably null
R0044:Ptprd UTSW 4 76086329 missense probably benign 0.08
R0044:Ptprd UTSW 4 76086329 missense probably benign 0.08
R0076:Ptprd UTSW 4 75947039 splice site probably benign
R0137:Ptprd UTSW 4 76136903 missense probably benign 0.24
R0358:Ptprd UTSW 4 75944989 missense probably damaging 1.00
R0365:Ptprd UTSW 4 76136846 missense probably damaging 1.00
R0385:Ptprd UTSW 4 76128665 missense probably damaging 1.00
R0601:Ptprd UTSW 4 76100474 missense probably benign
R0646:Ptprd UTSW 4 76084403 missense probably damaging 0.99
R0667:Ptprd UTSW 4 75957346 missense probably damaging 1.00
R0707:Ptprd UTSW 4 75957239 missense probably damaging 1.00
R0734:Ptprd UTSW 4 76140597 missense probably damaging 1.00
R0827:Ptprd UTSW 4 76128915 missense probably damaging 0.98
R0932:Ptprd UTSW 4 76136885 missense probably damaging 1.00
R1069:Ptprd UTSW 4 75998487 splice site probably benign
R1069:Ptprd UTSW 4 76100633 nonsense probably null
R1086:Ptprd UTSW 4 76133258 missense probably damaging 1.00
R1439:Ptprd UTSW 4 76066200 missense probably damaging 1.00
R1440:Ptprd UTSW 4 76084552 missense probably damaging 0.98
R1688:Ptprd UTSW 4 75982684 missense probably damaging 1.00
R1858:Ptprd UTSW 4 75947147 missense probably damaging 1.00
R2001:Ptprd UTSW 4 75954122 missense probably damaging 1.00
R2020:Ptprd UTSW 4 76133161 missense probably damaging 1.00
R2023:Ptprd UTSW 4 75957104 missense probably damaging 1.00
R2413:Ptprd UTSW 4 76133200 missense probably damaging 1.00
R2510:Ptprd UTSW 4 76086011 critical splice donor site probably null
R2914:Ptprd UTSW 4 75947101 missense probably damaging 1.00
R2971:Ptprd UTSW 4 76107324 missense probably benign 0.10
R3051:Ptprd UTSW 4 76100630 missense probably damaging 1.00
R3433:Ptprd UTSW 4 76086011 critical splice donor site probably null
R3964:Ptprd UTSW 4 76059836 splice site probably benign
R4009:Ptprd UTSW 4 75956397 missense possibly damaging 0.94
R4394:Ptprd UTSW 4 76128685 missense probably damaging 1.00
R4420:Ptprd UTSW 4 76039377 missense possibly damaging 0.92
R4424:Ptprd UTSW 4 76102963 missense probably benign 0.22
R4575:Ptprd UTSW 4 76243786 missense possibly damaging 0.55
R4578:Ptprd UTSW 4 76243786 missense possibly damaging 0.55
R4715:Ptprd UTSW 4 76107333 missense probably benign 0.03
R4782:Ptprd UTSW 4 76091532 missense probably benign 0.01
R4785:Ptprd UTSW 4 76140553 missense probably benign 0.05
R4799:Ptprd UTSW 4 76091532 missense probably benign 0.01
R4944:Ptprd UTSW 4 76128899 missense probably damaging 1.00
R4950:Ptprd UTSW 4 76140515 splice site probably null
R4969:Ptprd UTSW 4 76133305 missense probably damaging 1.00
R5153:Ptprd UTSW 4 76012102 missense probably damaging 1.00
R5164:Ptprd UTSW 4 76100758 splice site probably null
R5287:Ptprd UTSW 4 75954168 nonsense probably null
R5305:Ptprd UTSW 4 75982626 missense probably damaging 1.00
R5362:Ptprd UTSW 4 76128813 missense probably damaging 1.00
R5403:Ptprd UTSW 4 75954168 nonsense probably null
R5531:Ptprd UTSW 4 76059667 critical splice donor site probably null
R5543:Ptprd UTSW 4 76059753 missense probably damaging 1.00
R5634:Ptprd UTSW 4 76072018 missense probably benign 0.01
R5719:Ptprd UTSW 4 76054602 critical splice acceptor site probably null
R5884:Ptprd UTSW 4 75982690 missense probably damaging 1.00
R6247:Ptprd UTSW 4 76066291 missense probably benign 0.06
R6250:Ptprd UTSW 4 76128995 missense probably damaging 1.00
R6335:Ptprd UTSW 4 75954183 missense probably damaging 1.00
R6352:Ptprd UTSW 4 76091552 unclassified probably null
R6533:Ptprd UTSW 4 76128528 missense probably damaging 1.00
R6756:Ptprd UTSW 4 75955299 missense probably damaging 1.00
R6782:Ptprd UTSW 4 76325140 intron probably null
R7131:Ptprd UTSW 4 76066340 missense probably damaging 1.00
R7170:Ptprd UTSW 4 76071962 missense probably benign 0.06
R7233:Ptprd UTSW 4 76059783 missense probably benign 0.00
R7246:Ptprd UTSW 4 76128676 missense probably damaging 1.00
R7413:Ptprd UTSW 4 76246839 missense probably benign 0.00
R7428:Ptprd UTSW 4 76086468 missense probably benign 0.03
R7442:Ptprd UTSW 4 76059821 nonsense probably null
R7491:Ptprd UTSW 4 76133155 missense probably benign 0.23
R7526:Ptprd UTSW 4 76066327 missense probably benign 0.00
R7609:Ptprd UTSW 4 76072003 missense probably benign 0.03
R7612:Ptprd UTSW 4 76086459 missense probably benign 0.45
R7659:Ptprd UTSW 4 76128916 missense probably benign 0.03
R7743:Ptprd UTSW 4 76086089 missense probably damaging 1.00
R7748:Ptprd UTSW 4 76099504 missense probably null 0.39
R7788:Ptprd UTSW 4 75998604 missense probably damaging 1.00
R7836:Ptprd UTSW 4 75982644 missense probably damaging 0.99
R7937:Ptprd UTSW 4 76095535 missense probably benign 0.00
R8000:Ptprd UTSW 4 76066242 missense possibly damaging 0.95
R8018:Ptprd UTSW 4 76085520 missense probably damaging 0.98
R8072:Ptprd UTSW 4 76086036 missense probably benign 0.01
R8119:Ptprd UTSW 4 76129026 missense probably benign 0.00
R8387:Ptprd UTSW 4 75955289 missense probably damaging 1.00
RF023:Ptprd UTSW 4 76128565 missense probably damaging 0.98
Z1176:Ptprd UTSW 4 76133214 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTCCTGTCTGAGTGATGACTTG -3'
(R):5'- TTGCCGGATTAAGTCCCTACTC -3'

Sequencing Primer
(F):5'- GTCTGAGTGATGACTTGTATATCAC -3'
(R):5'- CGGATTAAGTCCCTACTCGGATTATG -3'
Posted On2019-12-04