Incidental Mutation 'RF030:Pdik1l'
ID604302
Institutional Source Beutler Lab
Gene Symbol Pdik1l
Ensembl Gene ENSMUSG00000050890
Gene NamePDLIM1 interacting kinase 1 like
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF030 (G1)
Quality Score214.458
Status Not validated
Chromosome4
Chromosomal Location134275002-134287895 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to CCACCAA at 134279516 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061234] [ENSMUST00000105876] [ENSMUST00000105877] [ENSMUST00000127857] [ENSMUST00000145006]
Predicted Effect probably benign
Transcript: ENSMUST00000061234
SMART Domains Protein: ENSMUSP00000060381
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 106 3e-8 PFAM
Pfam:Pkinase 8 328 2.2e-52 PFAM
Pfam:Pkinase_Tyr 99 329 5.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105876
SMART Domains Protein: ENSMUSP00000101502
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 106 3e-8 PFAM
Pfam:Pkinase 8 328 2.2e-52 PFAM
Pfam:Pkinase_Tyr 99 329 5.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105877
SMART Domains Protein: ENSMUSP00000101503
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 84 184 2.2e-7 PFAM
Pfam:Pkinase 84 402 4.5e-51 PFAM
Pfam:Pkinase_Tyr 185 405 6.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127857
SMART Domains Protein: ENSMUSP00000117719
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase 8 113 3.4e-12 PFAM
Pfam:Pkinase_Tyr 8 136 8.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145006
SMART Domains Protein: ENSMUSP00000118116
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 185 4.1e-24 PFAM
Pfam:Pkinase 10 187 4.9e-38 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GGC GGCTGC 19: 5,425,226 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,235 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Ankhd1 GCGGCG GCGGCGCCGGCG 18: 36,560,913 probably benign Het
Ankhd1 GGCGGCAGC GGCGGCAGCGGCAGC 18: 36,560,927 probably benign Het
AY761185 GGGCACTGTGG GGG 8: 20,943,900 probably null Het
B430218F22Rik GG GGTCGGCG 13: 118,386,848 probably benign Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGATGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Cox7a2l GGA GGATAGGGA 17: 83,502,722 probably benign Het
Cul9 CCTC CCTCCTC 17: 46,500,869 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Cyb5r4 TGCCCAGGGATGTGACAGACACAC TGCCCAGGGATGTGACAGACACACGGCCCAGGGATGTGACAGACACAC 9: 87,040,415 probably benign Het
Dmkn GTG GTGTTGGAAGTGGTGGAAGTGGTGGAAATG 7: 30,767,182 probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eed C A 7: 89,955,032 A411S probably benign Het
Fer1l4 GGTC G 2: 156,045,529 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 CTTTT CT X: 74,999,977 probably benign Het
Gab3 TCT TCTGCT X: 75,000,005 probably benign Het
Gab3 TCT TCTCCT X: 75,000,008 probably benign Het
Gab3 TTC TTCGTC X: 75,000,025 probably benign Het
Gab3 TCT TCTGCT X: 75,000,026 probably benign Het
Gm35339 AGGAGGAGG AG 15: 76,363,165 probably null Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,427,156 probably null Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Gucy2d C CTGGGGCCTG 7: 98,459,034 probably benign Het
Hsdl2 CCACAGCTGCAG CCACAGCTGCAGCAGCAGACACAGCTGCAG 4: 59,610,647 probably benign Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Il2 GG GGGCTTGAAGTGTG 3: 37,125,842 probably benign Het
Kmt2b CTCCTC CTCCTCTTCCTC 7: 30,586,377 probably benign Het
Lce1m C CGGCTGCTGCCAA 3: 93,018,141 probably benign Het
Lce1m GCTGCCAC GCTGCCACAGCAACTTCTGCCAC 3: 93,018,344 probably benign Het
Lrmp ATTG ATTGAGCACGTTG 6: 145,173,788 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Mamld1 CAG CAGTAG X: 71,118,828 probably null Het
Map1a CAGCTCCA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCTAGCTCCA 2: 121,306,311 probably benign Het
Map1a CA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCAA 2: 121,306,317 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Pkhd1l1 TTTTTTT TTTTTTTTTGTTTTTT 15: 44,558,502 probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCCCTCTCTCTCTCTCT 10: 84,858,480 probably benign Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,301 probably benign Het
Setd1a GGTGGTAGT GGTGGTAGTTGTGGTAGT 7: 127,785,311 probably benign Het
Six5 CGGA C 7: 19,094,800 probably benign Het
Tcof1 CCAGA CCAGACATCCCCTTGGCTGCTGAGCTGGGCACTTTCTCAGA 18: 60,833,568 probably benign Het
Tcof1 ATCCCCTTGGC ATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGAGGTCCCCTTGGC 18: 60,833,574 probably benign Het
Tcof1 CTGCTGCTGC CTGCTGCTGCTGC 18: 60,835,723 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCACCA 17: 47,786,112 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,113 probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGCGGGCTTG 6: 72,616,036 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCTGTCCCGCAAGGCCGGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Trappc9 TGCTGCT TGCTGCTGCTGCTGCGGCTGCT 15: 72,801,325 probably benign Het
Tsen2 GGA GGACGA 6: 115,560,067 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Other mutations in Pdik1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02439:Pdik1l APN 4 134278704 missense probably benign 0.11
FR4304:Pdik1l UTSW 4 134279374 frame shift probably null
FR4340:Pdik1l UTSW 4 134279512 intron probably benign
FR4342:Pdik1l UTSW 4 134279509 intron probably benign
FR4548:Pdik1l UTSW 4 134279512 intron probably benign
FR4589:Pdik1l UTSW 4 134279368 frame shift probably null
FR4589:Pdik1l UTSW 4 134279369 frame shift probably null
FR4737:Pdik1l UTSW 4 134279367 frame shift probably null
FR4737:Pdik1l UTSW 4 134279506 intron probably benign
FR4976:Pdik1l UTSW 4 134279506 intron probably benign
R1867:Pdik1l UTSW 4 134278911 missense probably damaging 1.00
R2106:Pdik1l UTSW 4 134284254 missense probably damaging 1.00
R2303:Pdik1l UTSW 4 134284248 nonsense probably null
R2398:Pdik1l UTSW 4 134278399 missense probably benign 0.01
R3162:Pdik1l UTSW 4 134284250 missense probably damaging 1.00
R3162:Pdik1l UTSW 4 134284250 missense probably damaging 1.00
R4515:Pdik1l UTSW 4 134278896 missense probably damaging 1.00
R4711:Pdik1l UTSW 4 134278990 missense probably benign 0.15
R5602:Pdik1l UTSW 4 134284269 missense probably damaging 0.99
R5822:Pdik1l UTSW 4 134287163 missense possibly damaging 0.53
R6031:Pdik1l UTSW 4 134279041 missense probably damaging 0.98
R6031:Pdik1l UTSW 4 134279041 missense probably damaging 0.98
R7517:Pdik1l UTSW 4 134278425 missense possibly damaging 0.83
R7705:Pdik1l UTSW 4 134279493 missense unknown
RF002:Pdik1l UTSW 4 134279375 frame shift probably null
RF007:Pdik1l UTSW 4 134279368 frame shift probably null
RF008:Pdik1l UTSW 4 134279511 intron probably benign
RF022:Pdik1l UTSW 4 134279367 frame shift probably null
RF025:Pdik1l UTSW 4 134286594 frame shift probably null
RF026:Pdik1l UTSW 4 134286594 intron probably benign
RF031:Pdik1l UTSW 4 134279374 frame shift probably null
RF034:Pdik1l UTSW 4 134279374 frame shift probably null
RF035:Pdik1l UTSW 4 134279510 intron probably benign
RF040:Pdik1l UTSW 4 134279515 intron probably benign
RF048:Pdik1l UTSW 4 134279372 frame shift probably null
RF056:Pdik1l UTSW 4 134279502 intron probably benign
RF056:Pdik1l UTSW 4 134279516 intron probably benign
RF057:Pdik1l UTSW 4 134279368 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTAGTTTAAGATGCACAGAGGTTG -3'
(R):5'- AGGCAGATCTCTGAGTTCGAG -3'

Sequencing Primer
(F):5'- CTCAGGTCCTCAATAAGCATGGTG -3'
(R):5'- GGCCAGCCTGGTCTATAAAGTG -3'
Posted On2019-12-04