Incidental Mutation 'RF030:Ankhd1'
ID604336
Institutional Source Beutler Lab
Gene Symbol Ankhd1
Ensembl Gene ENSMUSG00000024483
Gene Nameankyrin repeat and KH domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF030 (G1)
Quality Score217.468
Status Not validated
Chromosome18
Chromosomal Location36559987-36665917 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GCGGCG to GCGGCGCCGGCG at 36560913 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]
Predicted Effect probably benign
Transcript: ENSMUST00000006205
SMART Domains Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134146
SMART Domains Protein: ENSMUSP00000122136
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 17 35 N/A INTRINSIC
ANK 140 169 2.11e2 SMART
ANK 173 202 3.31e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142977
SMART Domains Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155329
SMART Domains Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2342 2362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GGC GGCTGC 19: 5,425,226 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,235 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
AY761185 GGGCACTGTGG GGG 8: 20,943,900 probably null Het
B430218F22Rik GG GGTCGGCG 13: 118,386,848 probably benign Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGATGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Cox7a2l GGA GGATAGGGA 17: 83,502,722 probably benign Het
Cul9 CCTC CCTCCTC 17: 46,500,869 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Cyb5r4 TGCCCAGGGATGTGACAGACACAC TGCCCAGGGATGTGACAGACACACGGCCCAGGGATGTGACAGACACAC 9: 87,040,415 probably benign Het
Dmkn GTG GTGTTGGAAGTGGTGGAAGTGGTGGAAATG 7: 30,767,182 probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eed C A 7: 89,955,032 A411S probably benign Het
Fer1l4 GGTC G 2: 156,045,529 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 CTTTT CT X: 74,999,977 probably benign Het
Gab3 TCT TCTGCT X: 75,000,005 probably benign Het
Gab3 TCT TCTCCT X: 75,000,008 probably benign Het
Gab3 TTC TTCGTC X: 75,000,025 probably benign Het
Gab3 TCT TCTGCT X: 75,000,026 probably benign Het
Gm35339 AGGAGGAGG AG 15: 76,363,165 probably null Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,427,156 probably null Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Gucy2d C CTGGGGCCTG 7: 98,459,034 probably benign Het
Hsdl2 CCACAGCTGCAG CCACAGCTGCAGCAGCAGACACAGCTGCAG 4: 59,610,647 probably benign Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Il2 GG GGGCTTGAAGTGTG 3: 37,125,842 probably benign Het
Kmt2b CTCCTC CTCCTCTTCCTC 7: 30,586,377 probably benign Het
Lce1m C CGGCTGCTGCCAA 3: 93,018,141 probably benign Het
Lce1m GCTGCCAC GCTGCCACAGCAACTTCTGCCAC 3: 93,018,344 probably benign Het
Lrmp ATTG ATTGAGCACGTTG 6: 145,173,788 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Mamld1 CAG CAGTAG X: 71,118,828 probably null Het
Map1a CAGCTCCA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCTAGCTCCA 2: 121,306,311 probably benign Het
Map1a CA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCAA 2: 121,306,317 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Pdik1l C CCACCAA 4: 134,279,516 probably benign Het
Pkhd1l1 TTTTTTT TTTTTTTTTGTTTTTT 15: 44,558,502 probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCCCTCTCTCTCTCTCT 10: 84,858,480 probably benign Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,301 probably benign Het
Setd1a GGTGGTAGT GGTGGTAGTTGTGGTAGT 7: 127,785,311 probably benign Het
Six5 CGGA C 7: 19,094,800 probably benign Het
Tcof1 CCAGA CCAGACATCCCCTTGGCTGCTGAGCTGGGCACTTTCTCAGA 18: 60,833,568 probably benign Het
Tcof1 ATCCCCTTGGC ATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGAGGTCCCCTTGGC 18: 60,833,574 probably benign Het
Tcof1 CTGCTGCTGC CTGCTGCTGCTGC 18: 60,835,723 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCACCA 17: 47,786,112 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,113 probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGCGGGCTTG 6: 72,616,036 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCTGTCCCGCAAGGCCGGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Trappc9 TGCTGCT TGCTGCTGCTGCTGCGGCTGCT 15: 72,801,325 probably benign Het
Tsen2 GGA GGACGA 6: 115,560,067 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Other mutations in Ankhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ankhd1 APN 18 36665459 unclassified probably benign
IGL00927:Ankhd1 APN 18 36632072 missense probably benign 0.01
IGL01367:Ankhd1 APN 18 36578643 missense probably benign 0.16
IGL01624:Ankhd1 APN 18 36658013 missense probably damaging 1.00
IGL01725:Ankhd1 APN 18 36648153 missense probably benign 0.04
IGL01767:Ankhd1 APN 18 36648374 missense probably damaging 1.00
IGL02005:Ankhd1 APN 18 36648426 missense probably damaging 1.00
IGL02009:Ankhd1 APN 18 36624661 missense probably damaging 1.00
IGL02246:Ankhd1 APN 18 36656726 missense probably damaging 1.00
IGL02336:Ankhd1 APN 18 36594814 missense probably damaging 0.97
IGL02628:Ankhd1 APN 18 36647703 missense probably benign 0.00
IGL02644:Ankhd1 APN 18 36578775 critical splice donor site probably null
IGL02735:Ankhd1 APN 18 36648546 missense probably benign 0.00
IGL02877:Ankhd1 APN 18 36594823 missense probably damaging 1.00
IGL03129:Ankhd1 APN 18 36658008 nonsense probably null
IGL03163:Ankhd1 APN 18 36647628 missense probably damaging 0.97
IGL03182:Ankhd1 APN 18 36578774 missense probably benign 0.06
IGL03184:Ankhd1 APN 18 36647777 missense probably damaging 1.00
IGL03398:Ankhd1 APN 18 36656837 splice site probably benign
FR4304:Ankhd1 UTSW 18 36560924 small insertion probably benign
R0051:Ankhd1 UTSW 18 36647188 unclassified probably benign
R0089:Ankhd1 UTSW 18 36640356 missense probably damaging 0.99
R0105:Ankhd1 UTSW 18 36646766 missense probably damaging 1.00
R0149:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0243:Ankhd1 UTSW 18 36634734 missense probably damaging 1.00
R0322:Ankhd1 UTSW 18 36658008 nonsense probably null
R0361:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0389:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0418:Ankhd1 UTSW 18 36634300 missense probably damaging 1.00
R0443:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0540:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0607:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0738:Ankhd1 UTSW 18 36645249 splice site probably benign
R1127:Ankhd1 UTSW 18 36634346 missense probably damaging 1.00
R1434:Ankhd1 UTSW 18 36625159 missense probably benign 0.09
R1742:Ankhd1 UTSW 18 36625265 missense probably damaging 1.00
R1776:Ankhd1 UTSW 18 36647308 missense probably benign 0.17
R1856:Ankhd1 UTSW 18 36644527 missense probably benign 0.00
R1923:Ankhd1 UTSW 18 36648030 missense probably benign 0.08
R2044:Ankhd1 UTSW 18 36645113 missense probably benign 0.31
R2112:Ankhd1 UTSW 18 36641626 missense probably damaging 1.00
R2115:Ankhd1 UTSW 18 36634308 missense probably damaging 1.00
R2136:Ankhd1 UTSW 18 36647621 missense probably benign
R2196:Ankhd1 UTSW 18 36648379 missense probably damaging 1.00
R2291:Ankhd1 UTSW 18 36644333 missense probably benign 0.31
R2305:Ankhd1 UTSW 18 36642926 missense possibly damaging 0.59
R2309:Ankhd1 UTSW 18 36624765 missense probably damaging 1.00
R2519:Ankhd1 UTSW 18 36578543 intron probably null
R2958:Ankhd1 UTSW 18 36634729 missense probably damaging 1.00
R3978:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R3980:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R4159:Ankhd1 UTSW 18 36589540 missense possibly damaging 0.91
R4199:Ankhd1 UTSW 18 36661048 unclassified probably benign
R4323:Ankhd1 UTSW 18 36578633 missense probably damaging 1.00
R4356:Ankhd1 UTSW 18 36643043 nonsense probably null
R4496:Ankhd1 UTSW 18 36560786 missense probably damaging 0.98
R4551:Ankhd1 UTSW 18 36655507 unclassified probably null
R4590:Ankhd1 UTSW 18 36583644 missense probably damaging 1.00
R4667:Ankhd1 UTSW 18 36648021 missense possibly damaging 0.77
R4889:Ankhd1 UTSW 18 36578734 missense probably null 0.00
R4923:Ankhd1 UTSW 18 36589452 missense probably damaging 1.00
R5091:Ankhd1 UTSW 18 36625027 missense possibly damaging 0.68
R5254:Ankhd1 UTSW 18 36656715 missense probably benign 0.05
R5314:Ankhd1 UTSW 18 36561058 splice site probably null
R5336:Ankhd1 UTSW 18 36646716 missense probably damaging 1.00
R5367:Ankhd1 UTSW 18 36589408 missense probably damaging 1.00
R5384:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5385:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5387:Ankhd1 UTSW 18 36634644 missense probably damaging 1.00
R5458:Ankhd1 UTSW 18 36648485 missense probably benign 0.01
R5599:Ankhd1 UTSW 18 36560807 missense probably damaging 0.98
R5659:Ankhd1 UTSW 18 36561050 missense probably damaging 1.00
R5750:Ankhd1 UTSW 18 36624902 missense probably benign 0.00
R5874:Ankhd1 UTSW 18 36640269 missense possibly damaging 0.92
R5894:Ankhd1 UTSW 18 36647524 missense probably damaging 0.99
R5969:Ankhd1 UTSW 18 36600834 missense probably damaging 1.00
R6133:Ankhd1 UTSW 18 36625126 missense possibly damaging 0.77
R6190:Ankhd1 UTSW 18 36611809 missense possibly damaging 0.84
R6247:Ankhd1 UTSW 18 36654146 missense probably benign 0.00
R6512:Ankhd1 UTSW 18 36591456 missense probably damaging 1.00
R6649:Ankhd1 UTSW 18 36600783 unclassified probably null
R6653:Ankhd1 UTSW 18 36600783 unclassified probably null
R6763:Ankhd1 UTSW 18 36642969 missense probably benign 0.31
R6976:Ankhd1 UTSW 18 36648254 missense probably benign 0.00
R7075:Ankhd1 UTSW 18 36559989 missense
R7208:Ankhd1 UTSW 18 36625028 missense probably benign
R7305:Ankhd1 UTSW 18 36632205 missense
R7615:Ankhd1 UTSW 18 36656773 missense
R7654:Ankhd1 UTSW 18 36594101 missense probably damaging 1.00
R7781:Ankhd1 UTSW 18 36625205 missense probably damaging 1.00
R7842:Ankhd1 UTSW 18 36647828 missense probably benign 0.00
R7925:Ankhd1 UTSW 18 36647828 missense probably benign 0.00
R8006:Ankhd1 UTSW 18 36648719 missense
R8037:Ankhd1 UTSW 18 36638623 missense probably damaging 0.98
RF001:Ankhd1 UTSW 18 36560921 small insertion probably benign
RF004:Ankhd1 UTSW 18 36560910 small insertion probably benign
RF007:Ankhd1 UTSW 18 36560909 small insertion probably benign
RF008:Ankhd1 UTSW 18 36560924 small insertion probably benign
RF009:Ankhd1 UTSW 18 36560922 small insertion probably benign
RF013:Ankhd1 UTSW 18 36560926 small insertion probably benign
RF016:Ankhd1 UTSW 18 36560909 small insertion probably benign
RF016:Ankhd1 UTSW 18 36560910 small insertion probably benign
RF017:Ankhd1 UTSW 18 36560909 small insertion probably benign
RF018:Ankhd1 UTSW 18 36560912 small insertion probably benign
RF026:Ankhd1 UTSW 18 36560912 small insertion probably benign
RF030:Ankhd1 UTSW 18 36560927 small insertion probably benign
RF039:Ankhd1 UTSW 18 36560918 small insertion probably benign
RF043:Ankhd1 UTSW 18 36560917 small insertion probably benign
RF046:Ankhd1 UTSW 18 36560926 small insertion probably benign
RF047:Ankhd1 UTSW 18 36560917 small insertion probably benign
RF047:Ankhd1 UTSW 18 36560923 small insertion probably benign
RF049:Ankhd1 UTSW 18 36560923 small insertion probably benign
RF050:Ankhd1 UTSW 18 36560927 small insertion probably benign
RF054:Ankhd1 UTSW 18 36560929 small insertion probably benign
RF057:Ankhd1 UTSW 18 36560929 small insertion probably benign
RF060:Ankhd1 UTSW 18 36560922 small insertion probably benign
RF061:Ankhd1 UTSW 18 36560921 small insertion probably benign
RF062:Ankhd1 UTSW 18 36560918 small insertion probably benign
X0027:Ankhd1 UTSW 18 36624832 missense probably damaging 1.00
X0065:Ankhd1 UTSW 18 36578764 nonsense probably null
X0066:Ankhd1 UTSW 18 36646704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAACCATGCTGACGGAC -3'
(R):5'- TGTCAGAGAACACTGCACCG -3'

Sequencing Primer
(F):5'- CTGACGGACAGCGGGGG -3'
(R):5'- TGCGGGTCCAAAGAATTCC -3'
Posted On2019-12-04