Incidental Mutation 'RF002:Chga'
ID602576
Institutional Source Beutler Lab
Gene Symbol Chga
Ensembl Gene ENSMUSG00000021194
Gene Namechromogranin A
SynonymsChrA
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #RF002 (G1)
Quality Score189.468
Status Not validated
Chromosome12
Chromosomal Location102554969-102565028 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GCA to GCACCA at 102561421 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021610]
Predicted Effect probably benign
Transcript: ENSMUST00000021610
SMART Domains Protein: ENSMUSP00000021610
Gene: ENSMUSG00000021194

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Granin 25 95 3e-26 PFAM
Pfam:Granin 87 463 1.7e-95 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the granin family of acidic secretory glycoproteins that are expressed in endocrine cells and neurons. The encoded preproprotein undergoes proteolytic processing to generate multiple functions peptides including pancreastatin, catestatin and serpinin. The encoded protein plays important roles in the neuroendocrine system including regulated secretion of peptide hormones and neurotransmitters. Mice lacking the encoded protein exhibit elevated blood pressure which can be rescued by transgenic expression of the human ortholog. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes and heterozygotes for one allele display hypertension, abnormal plasma and adrenal adrenaline and noradrenaline levels and, in homozygotes, partial embryonic lethality. Homozygotes for a second allele only have elevated urinary adrenaline, noradrenaline and dopamine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,941,047 probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,050 probably benign Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,608,925 probably null Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 probably benign Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Chga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Chga APN 12 102562799 missense probably damaging 0.98
IGL02674:Chga APN 12 102562901 missense probably damaging 1.00
FR4589:Chga UTSW 12 102561402 small insertion probably benign
R0018:Chga UTSW 12 102558505 missense probably damaging 0.97
R0463:Chga UTSW 12 102562951 nonsense probably null
R1164:Chga UTSW 12 102563045 missense probably damaging 1.00
R1603:Chga UTSW 12 102564607 splice site probably null
R1727:Chga UTSW 12 102561437 missense possibly damaging 0.85
R1778:Chga UTSW 12 102561700 missense probably benign
R1800:Chga UTSW 12 102555905 missense probably damaging 0.99
R2071:Chga UTSW 12 102562863 missense probably damaging 1.00
R3415:Chga UTSW 12 102562784 missense probably benign 0.00
R3696:Chga UTSW 12 102561465 missense probably damaging 0.98
R5022:Chga UTSW 12 102562837 missense probably damaging 1.00
R5507:Chga UTSW 12 102562609 missense probably benign 0.39
R5959:Chga UTSW 12 102561855 missense probably benign
R7338:Chga UTSW 12 102562841 missense probably damaging 1.00
R7410:Chga UTSW 12 102562607 missense probably benign 0.00
R7694:Chga UTSW 12 102561347 missense probably benign 0.05
R8084:Chga UTSW 12 102562069 missense probably benign 0.29
R8211:Chga UTSW 12 102561419 missense possibly damaging 0.71
RF001:Chga UTSW 12 102561423 small insertion probably benign
RF006:Chga UTSW 12 102561412 small insertion probably benign
RF009:Chga UTSW 12 102561420 small insertion probably benign
RF010:Chga UTSW 12 102561403 small insertion probably benign
RF014:Chga UTSW 12 102561393 small insertion probably benign
RF014:Chga UTSW 12 102561405 small insertion probably benign
RF015:Chga UTSW 12 102561420 small insertion probably benign
RF022:Chga UTSW 12 102561420 small insertion probably benign
RF033:Chga UTSW 12 102561396 small insertion probably benign
RF035:Chga UTSW 12 102561427 small insertion probably benign
RF044:Chga UTSW 12 102561396 small insertion probably benign
RF048:Chga UTSW 12 102561403 small insertion probably benign
RF048:Chga UTSW 12 102561421 small insertion probably benign
RF049:Chga UTSW 12 102561393 small insertion probably benign
RF052:Chga UTSW 12 102561416 small insertion probably benign
RF054:Chga UTSW 12 102561423 small insertion probably benign
RF056:Chga UTSW 12 102561424 small insertion probably benign
RF058:Chga UTSW 12 102561416 small insertion probably benign
RF060:Chga UTSW 12 102561424 small insertion probably benign
RF061:Chga UTSW 12 102561413 small insertion probably benign
RF061:Chga UTSW 12 102561427 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ATAGCTGAGAGCCTGTACCC -3'
(R):5'- CGTCTGCAAACACAAATGGATAG -3'

Sequencing Primer
(F):5'- CTCAAGGGAGGCCTTCAGTGTTAC -3'
(R):5'- TCCTGAGGCCAAGTTCAATG -3'
Posted On2019-12-04