Incidental Mutation 'RF051:Manbal'
ID605135
Institutional Source Beutler Lab
Gene Symbol Manbal
Ensembl Gene ENSMUSG00000063019
Gene Namemannosidase, beta A, lysosomal-like
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF051 (G1)
Quality Score217.468
Status Not validated
Chromosome2
Chromosomal Location157367594-157396763 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) CGATAGAAT to C at 157396012 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000079965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081202]
Predicted Effect probably null
Transcript: ENSMUST00000081202
SMART Domains Protein: ENSMUSP00000079965
Gene: ENSMUSG00000063019

DomainStartEndE-ValueType
Pfam:UPF0239 1 85 3.3e-45 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cnpy3 CTC CTCATC 17: 46,736,748 probably benign Het
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Gabre CTCCGG CTCCGGGTCCGG X: 72,270,049 probably benign Het
Gm14399 G C 2: 175,131,201 Q254E probably benign Het
Hsdl2 TGC TGCCGGAGCAGCCACAGCGGC 4: 59,610,636 probably benign Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCAAAGCTGCAG 4: 59,610,650 probably benign Het
Il2 GGG GGGGCTTGAAGTGGG 3: 37,125,841 probably benign Het
Kmt2c CCTTCT CCT 5: 25,313,479 probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,306,296 probably benign Het
Mei1 GC GCTGGCTGCC 15: 82,070,010 probably null Het
Nbea TTTA T 3: 56,009,212 probably benign Het
Nefh TGGCC TGGCCGCACCTGGGGCCTCGGCC 11: 4,941,054 probably benign Het
Olfr1535 GCCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTATGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT GGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT 13: 21,555,523 probably null Het
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,534,775 probably benign Het
Plekhg2 GGTG GG 7: 28,362,352 probably null Het
Rassf6 AGCAATGGGGA AGCAATGGGGAATCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGA 5: 90,608,929 probably benign Het
Smarca2 AGCAGC AGCAGCCGCAGC 19: 26,630,988 probably benign Het
Stard8 GAG GAGCAG X: 99,066,524 probably benign Het
Tcof1 CTTGGC CTTGGCTGCTGAGATGGGCACTTTCCCAGAGATCCCATTGGC 18: 60,833,579 probably benign Het
Tmem28 GCCGCC GCCGCCACCGCC X: 99,821,362 probably benign Het
Triobp AGCCCCAGGACTCCCTGTGCCCAACGG AGCCCCAGGACTCCCTGTGCCCAACGGAACAGCCCCAGGACTCCCTGTGCCCAACGG 15: 78,967,034 probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTCT 9: 44,089,129 probably benign Het
Other mutations in Manbal
AlleleSourceChrCoordTypePredicted EffectPPH Score
RF035:Manbal UTSW 2 157396012 makesense probably null
Predicted Primers PCR Primer
(F):5'- TTGACAGCATCCCGTTGGTC -3'
(R):5'- TTGAGAATCTCCCGTGCAC -3'

Sequencing Primer
(F):5'- TGGTCAAGCTGGAGTCCTCTAAAC -3'
(R):5'- TCTGCACAGCTGGAGCCTAAG -3'
Posted On2019-12-04