Incidental Mutation 'R7897:Kcne3'
ID 609751
Institutional Source Beutler Lab
Gene Symbol Kcne3
Ensembl Gene ENSMUSG00000035165
Gene Name potassium voltage-gated channel, Isk-related subfamily, gene 3
Synonyms 2210017H05Rik, MiRP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R7897 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 100176502-100184869 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 100184313 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 46 (R46G)
Ref Sequence ENSEMBL: ENSMUSP00000039353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049333] [ENSMUST00000170954] [ENSMUST00000178946] [ENSMUST00000179842] [ENSMUST00000207358] [ENSMUST00000207995] [ENSMUST00000208260]
AlphaFold Q9WTW2
Predicted Effect probably benign
Transcript: ENSMUST00000049333
AA Change: R46G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039353
Gene: ENSMUSG00000035165
AA Change: R46G

DomainStartEndE-ValueType
Pfam:ISK_Channel 36 101 2.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170954
AA Change: R46G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130019
Gene: ENSMUSG00000035165
AA Change: R46G

DomainStartEndE-ValueType
Pfam:ISK_Channel 36 101 2.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178946
AA Change: R46G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136616
Gene: ENSMUSG00000035165
AA Change: R46G

DomainStartEndE-ValueType
Pfam:ISK_Channel 20 101 1.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179842
AA Change: R46G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136415
Gene: ENSMUSG00000035165
AA Change: R46G

DomainStartEndE-ValueType
Pfam:ISK_Channel 36 101 2.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207358
AA Change: R46G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207995
AA Change: R46G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208260
AA Change: R46G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, isk-related subfamily. This member is a type I membrane protein, and a beta subunit that assembles with a potassium channel alpha-subunit to modulate the gating kinetics and enhance stability of the multimeric complex. This gene is prominently expressed in the kidney. A missense mutation in this gene is associated with hypokalemic periodic paralysis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased cAMP-stimulated electrogenic Cl- secretion across tracheal and intestinal epithelia. Another knock-out allele shows age-dependent alterations in action potential and firing properties of spiral ganglion neurons in the cochlea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A C 9: 105,144,510 Y112* probably null Het
Abcb11 TGTTGATCCATA T 2: 69,323,872 probably null Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Abcc10 T C 17: 46,324,073 T335A probably benign Het
Actr3b T C 5: 25,831,659 Y245H probably benign Het
Afm G A 5: 90,547,868 M411I probably benign Het
Ahr T C 12: 35,504,170 N650S possibly damaging Het
Ap5m1 A G 14: 49,073,775 R101G probably benign Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 135,745,704 probably benign Het
Atp13a4 T C 16: 29,396,466 Q1151R Het
Bcl9 A G 3: 97,205,251 V1296A possibly damaging Het
Bsn A C 9: 108,111,866 M2229R probably damaging Het
Cfap74 T C 4: 155,429,894 V529A Het
Clip1 C T 5: 123,622,798 V767M probably benign Het
Col6a5 A G 9: 105,889,183 I1846T possibly damaging Het
Crisp1 A T 17: 40,307,765 D68E probably benign Het
Csmd1 A T 8: 17,534,919 L19Q possibly damaging Het
Cul7 T C 17: 46,658,005 I892T probably benign Het
Elavl3 G A 9: 22,018,550 R353C probably damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fbxo3 A G 2: 104,053,412 D327G possibly damaging Het
Galr1 T C 18: 82,406,131 N7S probably benign Het
Glyatl3 T C 17: 40,904,911 T235A probably damaging Het
Gm11639 A T 11: 104,998,235 Y4159F probably benign Het
Gm5145 A C 17: 20,570,705 Q115P probably benign Het
Grm5 T C 7: 88,130,861 S1202P probably benign Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Jmjd1c A G 10: 67,239,865 N1837S probably damaging Het
Jph3 A T 8: 121,789,397 probably null Het
Kcna6 A G 6: 126,738,798 L376P probably damaging Het
Kcnq2 T C 2: 181,081,141 D842G probably damaging Het
Klhl12 A T 1: 134,458,481 I4F probably benign Het
Kpna1 T A 16: 36,033,865 I525N probably benign Het
Krtap31-1 T C 11: 99,908,123 C51R possibly damaging Het
Ms4a12 C T 19: 11,230,359 G61D possibly damaging Het
Nol4 T C 18: 22,823,343 N115D Het
Pcdh15 A G 10: 74,453,995 Y882C probably damaging Het
Pde8b T A 13: 95,107,694 H79L probably benign Het
Pdia2 T C 17: 26,198,233 E79G probably benign Het
Pgap1 A T 1: 54,551,008 F90L probably damaging Het
Pik3cd T A 4: 149,657,269 T407S probably benign Het
Pkd1l2 G T 8: 116,998,088 F2361L possibly damaging Het
Pla2g12b A T 10: 59,410,994 R77* probably null Het
Ppfia2 A G 10: 106,819,538 Y322C probably damaging Het
Psg23 T C 7: 18,607,183 Q382R possibly damaging Het
Ptprq A G 10: 107,710,623 V270A probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Robo2 T C 16: 73,898,950 E1431G probably benign Het
Sdk2 A G 11: 113,873,201 I253T possibly damaging Het
Sox9 A C 11: 112,784,809 I275L probably benign Het
Tlr4 A G 4: 66,839,821 I284V probably benign Het
Unc13b A G 4: 43,171,860 D896G unknown Het
Usp48 A T 4: 137,644,428 H955L probably damaging Het
Vps54 T C 11: 21,263,307 I30T probably benign Het
Zfp106 G A 2: 120,535,615 R59* probably null Het
Zmym4 A T 4: 126,889,539 D1169E possibly damaging Het
Zscan2 T A 7: 80,875,700 Y390N probably damaging Het
Other mutations in Kcne3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Kcne3 APN 7 100184490 utr 3 prime probably benign
IGL02499:Kcne3 APN 7 100184403 missense probably benign 0.24
R0632:Kcne3 UTSW 7 100184439 missense probably damaging 1.00
R1743:Kcne3 UTSW 7 100184424 missense probably damaging 1.00
R9418:Kcne3 UTSW 7 100184178 start codon destroyed probably null 0.99
Predicted Primers PCR Primer
(F):5'- GGAAGTTGTTCACGACATGGG -3'
(R):5'- CATAGACACACGGTTCTTGATG -3'

Sequencing Primer
(F):5'- TTGTTCACGACATGGGTAAAAAGCC -3'
(R):5'- GACACACGGTTCTTGATGTACAC -3'
Posted On 2019-12-20