Incidental Mutation 'R7897:Pdia2'
ID 609779
Institutional Source Beutler Lab
Gene Symbol Pdia2
Ensembl Gene ENSMUSG00000024184
Gene Name protein disulfide isomerase associated 2
Synonyms Pdipl, 1810041F13Rik, Pdip
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R7897 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 26195999-26199087 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26198233 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 79 (E79G)
Ref Sequence ENSEMBL: ENSMUSP00000035584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025019] [ENSMUST00000025020] [ENSMUST00000039113] [ENSMUST00000074370] [ENSMUST00000118904] [ENSMUST00000120333] [ENSMUST00000121959] [ENSMUST00000122058] [ENSMUST00000163421] [ENSMUST00000176961]
AlphaFold D3Z6P0
Predicted Effect probably benign
Transcript: ENSMUST00000025019
SMART Domains Protein: ENSMUSP00000025019
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
Pfam:Rho_GDI 29 222 1.2e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025020
SMART Domains Protein: ENSMUSP00000025020
Gene: ENSMUSG00000024186

DomainStartEndE-ValueType
DEP 34 109 7.78e-17 SMART
G_gamma 220 284 1.38e-19 SMART
GGL 223 284 1.1e-26 SMART
RGS 303 418 6.23e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039113
AA Change: E79G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035584
Gene: ENSMUSG00000024184
AA Change: E79G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 46 153 1.5e-26 PFAM
Pfam:Thioredoxin_6 182 369 3.2e-37 PFAM
Pfam:Thioredoxin 392 497 2.4e-27 PFAM
low complexity region 501 515 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074370
SMART Domains Protein: ENSMUSP00000073974
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 13 85 7.5e-27 PFAM
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 523 3.2e-13 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
low complexity region 713 727 N/A INTRINSIC
DAX 786 868 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118904
SMART Domains Protein: ENSMUSP00000113756
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120333
AA Change: E79G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114080
Gene: ENSMUSG00000024184
AA Change: E79G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 46 153 2.6e-27 PFAM
Pfam:Thioredoxin_6 181 366 2e-37 PFAM
Pfam:Thioredoxin 389 494 7.2e-28 PFAM
low complexity region 498 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121959
SMART Domains Protein: ENSMUSP00000113186
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
Pfam:Rho_GDI 14 197 6.4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122058
SMART Domains Protein: ENSMUSP00000113885
Gene: ENSMUSG00000024186

DomainStartEndE-ValueType
DEP 32 107 7.78e-17 SMART
G_gamma 218 282 1.38e-19 SMART
GGL 221 282 1.1e-26 SMART
RGS 301 416 6.23e-47 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000115267
Gene: ENSMUSG00000024184
AA Change: E70G

DomainStartEndE-ValueType
Pfam:Thioredoxin 38 145 3.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148134
SMART Domains Protein: ENSMUSP00000116340
Gene: ENSMUSG00000024184

DomainStartEndE-ValueType
Pfam:Thioredoxin 19 124 2e-28 PFAM
low complexity region 128 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163421
SMART Domains Protein: ENSMUSP00000132000
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176961
SMART Domains Protein: ENSMUSP00000135717
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
Pfam:Rho_GDI 14 222 1.9e-83 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, two catalytically active thioredoxin (TRX) domains, two TRX-like domains and a C-terminal ER-retention sequence. The protein plays a role in the folding of nascent proteins in the endoplasmic reticulum by forming disulfide bonds through its thiol isomerase, oxidase, and reductase activity. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A C 9: 105,144,510 Y112* probably null Het
Abcb11 TGTTGATCCATA T 2: 69,323,872 probably null Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Abcc10 T C 17: 46,324,073 T335A probably benign Het
Actr3b T C 5: 25,831,659 Y245H probably benign Het
Afm G A 5: 90,547,868 M411I probably benign Het
Ahr T C 12: 35,504,170 N650S possibly damaging Het
Ap5m1 A G 14: 49,073,775 R101G probably benign Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 135,745,704 probably benign Het
Atp13a4 T C 16: 29,396,466 Q1151R Het
Bcl9 A G 3: 97,205,251 V1296A possibly damaging Het
Bsn A C 9: 108,111,866 M2229R probably damaging Het
Cfap74 T C 4: 155,429,894 V529A Het
Clip1 C T 5: 123,622,798 V767M probably benign Het
Col6a5 A G 9: 105,889,183 I1846T possibly damaging Het
Crisp1 A T 17: 40,307,765 D68E probably benign Het
Csmd1 A T 8: 17,534,919 L19Q possibly damaging Het
Cul7 T C 17: 46,658,005 I892T probably benign Het
Elavl3 G A 9: 22,018,550 R353C probably damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fbxo3 A G 2: 104,053,412 D327G possibly damaging Het
Galr1 T C 18: 82,406,131 N7S probably benign Het
Glyatl3 T C 17: 40,904,911 T235A probably damaging Het
Gm11639 A T 11: 104,998,235 Y4159F probably benign Het
Gm5145 A C 17: 20,570,705 Q115P probably benign Het
Grm5 T C 7: 88,130,861 S1202P probably benign Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Jmjd1c A G 10: 67,239,865 N1837S probably damaging Het
Jph3 A T 8: 121,789,397 probably null Het
Kcna6 A G 6: 126,738,798 L376P probably damaging Het
Kcne3 C G 7: 100,184,313 R46G probably benign Het
Kcnq2 T C 2: 181,081,141 D842G probably damaging Het
Klhl12 A T 1: 134,458,481 I4F probably benign Het
Kpna1 T A 16: 36,033,865 I525N probably benign Het
Krtap31-1 T C 11: 99,908,123 C51R possibly damaging Het
Ms4a12 C T 19: 11,230,359 G61D possibly damaging Het
Nol4 T C 18: 22,823,343 N115D Het
Pcdh15 A G 10: 74,453,995 Y882C probably damaging Het
Pde8b T A 13: 95,107,694 H79L probably benign Het
Pgap1 A T 1: 54,551,008 F90L probably damaging Het
Pik3cd T A 4: 149,657,269 T407S probably benign Het
Pkd1l2 G T 8: 116,998,088 F2361L possibly damaging Het
Pla2g12b A T 10: 59,410,994 R77* probably null Het
Ppfia2 A G 10: 106,819,538 Y322C probably damaging Het
Psg23 T C 7: 18,607,183 Q382R possibly damaging Het
Ptprq A G 10: 107,710,623 V270A probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Robo2 T C 16: 73,898,950 E1431G probably benign Het
Sdk2 A G 11: 113,873,201 I253T possibly damaging Het
Sox9 A C 11: 112,784,809 I275L probably benign Het
Tlr4 A G 4: 66,839,821 I284V probably benign Het
Unc13b A G 4: 43,171,860 D896G unknown Het
Usp48 A T 4: 137,644,428 H955L probably damaging Het
Vps54 T C 11: 21,263,307 I30T probably benign Het
Zfp106 G A 2: 120,535,615 R59* probably null Het
Zmym4 A T 4: 126,889,539 D1169E possibly damaging Het
Zscan2 T A 7: 80,875,700 Y390N probably damaging Het
Other mutations in Pdia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Pdia2 APN 17 26198116 missense probably damaging 0.98
IGL01019:Pdia2 APN 17 26198922 missense probably damaging 1.00
IGL02289:Pdia2 APN 17 26197890 missense possibly damaging 0.66
IGL02725:Pdia2 APN 17 26196532 missense probably benign 0.05
Feline UTSW 17 26198868 missense probably benign 0.00
Hongry UTSW 17 26197660 missense possibly damaging 0.72
Ravenous UTSW 17 26196521 missense probably damaging 1.00
R0553:Pdia2 UTSW 17 26196243 missense probably damaging 0.98
R0988:Pdia2 UTSW 17 26198829 missense probably damaging 1.00
R1624:Pdia2 UTSW 17 26196521 missense probably damaging 1.00
R1917:Pdia2 UTSW 17 26198105 missense possibly damaging 0.82
R3950:Pdia2 UTSW 17 26197616 critical splice donor site probably null
R4583:Pdia2 UTSW 17 26196502 missense probably damaging 1.00
R5455:Pdia2 UTSW 17 26197163 missense probably null 0.99
R6841:Pdia2 UTSW 17 26196604 splice site probably null
R6889:Pdia2 UTSW 17 26196970 nonsense probably null
R7312:Pdia2 UTSW 17 26197660 missense possibly damaging 0.72
R7743:Pdia2 UTSW 17 26198868 missense probably benign 0.00
R8518:Pdia2 UTSW 17 26198170 nonsense probably null
R9187:Pdia2 UTSW 17 26196936 missense probably damaging 0.98
R9449:Pdia2 UTSW 17 26197200 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACCTGTGTACTTGCCCAC -3'
(R):5'- GGAAACAGGATTCTTGTCTTTGTC -3'

Sequencing Primer
(F):5'- GTACCTGCGTACTCTTCTGGG -3'
(R):5'- TTGTCTGGGATCTGGCACCC -3'
Posted On 2019-12-20