Incidental Mutation 'R7897:Glyatl3'
ID 609781
Institutional Source Beutler Lab
Gene Symbol Glyatl3
Ensembl Gene ENSMUSG00000091043
Gene Name glycine-N-acyltransferase-like 3
Synonyms Gm5683
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7897 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 40904741-40914350 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40904911 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 235 (T235A)
Ref Sequence ENSEMBL: ENSMUSP00000125916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166343]
AlphaFold E9Q5L8
Predicted Effect probably damaging
Transcript: ENSMUST00000166343
AA Change: T235A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125916
Gene: ENSMUSG00000091043
AA Change: T235A

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 192 8.8e-82 PFAM
Pfam:FR47 193 269 1.6e-8 PFAM
Pfam:Gly_acyl_tr_C 193 281 1.6e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A C 9: 105,144,510 Y112* probably null Het
Abcb11 TGTTGATCCATA T 2: 69,323,872 probably null Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Abcc10 T C 17: 46,324,073 T335A probably benign Het
Actr3b T C 5: 25,831,659 Y245H probably benign Het
Afm G A 5: 90,547,868 M411I probably benign Het
Ahr T C 12: 35,504,170 N650S possibly damaging Het
Ap5m1 A G 14: 49,073,775 R101G probably benign Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 135,745,704 probably benign Het
Atp13a4 T C 16: 29,396,466 Q1151R Het
Bcl9 A G 3: 97,205,251 V1296A possibly damaging Het
Bsn A C 9: 108,111,866 M2229R probably damaging Het
Cfap74 T C 4: 155,429,894 V529A Het
Clip1 C T 5: 123,622,798 V767M probably benign Het
Col6a5 A G 9: 105,889,183 I1846T possibly damaging Het
Crisp1 A T 17: 40,307,765 D68E probably benign Het
Csmd1 A T 8: 17,534,919 L19Q possibly damaging Het
Cul7 T C 17: 46,658,005 I892T probably benign Het
Elavl3 G A 9: 22,018,550 R353C probably damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fbxo3 A G 2: 104,053,412 D327G possibly damaging Het
Galr1 T C 18: 82,406,131 N7S probably benign Het
Gm11639 A T 11: 104,998,235 Y4159F probably benign Het
Gm5145 A C 17: 20,570,705 Q115P probably benign Het
Grm5 T C 7: 88,130,861 S1202P probably benign Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Jmjd1c A G 10: 67,239,865 N1837S probably damaging Het
Jph3 A T 8: 121,789,397 probably null Het
Kcna6 A G 6: 126,738,798 L376P probably damaging Het
Kcne3 C G 7: 100,184,313 R46G probably benign Het
Kcnq2 T C 2: 181,081,141 D842G probably damaging Het
Klhl12 A T 1: 134,458,481 I4F probably benign Het
Kpna1 T A 16: 36,033,865 I525N probably benign Het
Krtap31-1 T C 11: 99,908,123 C51R possibly damaging Het
Ms4a12 C T 19: 11,230,359 G61D possibly damaging Het
Nol4 T C 18: 22,823,343 N115D Het
Pcdh15 A G 10: 74,453,995 Y882C probably damaging Het
Pde8b T A 13: 95,107,694 H79L probably benign Het
Pdia2 T C 17: 26,198,233 E79G probably benign Het
Pgap1 A T 1: 54,551,008 F90L probably damaging Het
Pik3cd T A 4: 149,657,269 T407S probably benign Het
Pkd1l2 G T 8: 116,998,088 F2361L possibly damaging Het
Pla2g12b A T 10: 59,410,994 R77* probably null Het
Ppfia2 A G 10: 106,819,538 Y322C probably damaging Het
Psg23 T C 7: 18,607,183 Q382R possibly damaging Het
Ptprq A G 10: 107,710,623 V270A probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Robo2 T C 16: 73,898,950 E1431G probably benign Het
Sdk2 A G 11: 113,873,201 I253T possibly damaging Het
Sox9 A C 11: 112,784,809 I275L probably benign Het
Tlr4 A G 4: 66,839,821 I284V probably benign Het
Unc13b A G 4: 43,171,860 D896G unknown Het
Usp48 A T 4: 137,644,428 H955L probably damaging Het
Vps54 T C 11: 21,263,307 I30T probably benign Het
Zfp106 G A 2: 120,535,615 R59* probably null Het
Zmym4 A T 4: 126,889,539 D1169E possibly damaging Het
Zscan2 T A 7: 80,875,700 Y390N probably damaging Het
Other mutations in Glyatl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2140:Glyatl3 UTSW 17 40911084 missense probably benign 0.01
R2142:Glyatl3 UTSW 17 40911084 missense probably benign 0.01
R4246:Glyatl3 UTSW 17 40910098 missense probably benign 0.15
R4939:Glyatl3 UTSW 17 40910023 splice site probably null
R5134:Glyatl3 UTSW 17 40905030 missense probably benign 0.08
R6966:Glyatl3 UTSW 17 40904938 missense probably damaging 1.00
R9005:Glyatl3 UTSW 17 40912728 nonsense probably null
R9185:Glyatl3 UTSW 17 40914343 missense probably damaging 1.00
R9288:Glyatl3 UTSW 17 40910125 missense probably benign 0.25
R9307:Glyatl3 UTSW 17 40912662 critical splice donor site probably null
R9397:Glyatl3 UTSW 17 40912674 nonsense probably null
R9481:Glyatl3 UTSW 17 40910125 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CGAGCTAAAGGTGAGCTTGTC -3'
(R):5'- AGTGTCTCAGATGCAGATCTTC -3'

Sequencing Primer
(F):5'- AGCTTGTCTTGAGAAAGCTGCAG -3'
(R):5'- GATGCAGATCTTCTCAACCGG -3'
Posted On 2019-12-20