Incidental Mutation 'R0686:Fus'
ID61171
Institutional Source Beutler Lab
Gene Symbol Fus
Ensembl Gene ENSMUSG00000030795
Gene Namefused in sarcoma
SynonymsD430004D17Rik, hnRNP P2, pigpen, D930039C12Rik, translocated in liposarcoma, Tls
MMRRC Submission 038871-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0686 (G1)
Quality Score143
Status Not validated
Chromosome7
Chromosomal Location127967457-127985701 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 127972763 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000077609] [ENSMUST00000106251] [ENSMUST00000121616]
Predicted Effect unknown
Transcript: ENSMUST00000077609
AA Change: G245S
SMART Domains Protein: ENSMUSP00000076801
Gene: ENSMUSG00000030795
AA Change: G245S

DomainStartEndE-ValueType
low complexity region 20 44 N/A INTRINSIC
low complexity region 48 67 N/A INTRINSIC
low complexity region 72 104 N/A INTRINSIC
low complexity region 110 179 N/A INTRINSIC
low complexity region 185 253 N/A INTRINSIC
RRM 278 359 3.85e-16 SMART
ZnF_RBZ 416 442 9e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000106251
AA Change: G246S
SMART Domains Protein: ENSMUSP00000101858
Gene: ENSMUSG00000030795
AA Change: G246S

DomainStartEndE-ValueType
low complexity region 20 44 N/A INTRINSIC
low complexity region 47 63 N/A INTRINSIC
low complexity region 73 105 N/A INTRINSIC
low complexity region 111 180 N/A INTRINSIC
low complexity region 186 254 N/A INTRINSIC
RRM 279 360 3.85e-16 SMART
ZnF_RBZ 417 443 9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121616
SMART Domains Protein: ENSMUSP00000112721
Gene: ENSMUSG00000030795

DomainStartEndE-ValueType
low complexity region 20 44 N/A INTRINSIC
low complexity region 47 63 N/A INTRINSIC
low complexity region 73 105 N/A INTRINSIC
low complexity region 111 176 N/A INTRINSIC
ZnF_RBZ 179 205 9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174196
Predicted Effect probably benign
Transcript: ENSMUST00000174632
SMART Domains Protein: ENSMUSP00000133820
Gene: ENSMUSG00000030795

DomainStartEndE-ValueType
Pfam:RRM_1 6 56 6.6e-9 PFAM
ZnF_RBZ 77 103 9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205261
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired lymphocyte development, chromosomal instability, increased cellular radiation sensitivity, high neonatal mortality, and male sterility associated with lack of chromosomal pairing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,928,518 S68F probably damaging Het
1700123K08Rik C T 5: 138,564,537 E42K possibly damaging Het
Arhgef12 A C 9: 42,993,028 L718R probably benign Het
Bsx T G 9: 40,876,437 S136A probably damaging Het
Ccne2 T A 4: 11,197,220 M174K possibly damaging Het
Ces1a A G 8: 93,022,449 Y445H probably damaging Het
Ckb A G 12: 111,670,193 V249A probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Cyp2r1 T G 7: 114,552,011 M358L possibly damaging Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Eps8l1 T A 7: 4,477,450 D563E probably benign Het
Fam102b G A 3: 108,992,685 R116C probably damaging Het
Fam160a2 G T 7: 105,388,309 L356I probably damaging Het
Fpr-rs4 A C 17: 18,022,351 I207L probably benign Het
Gm340 T A 19: 41,582,372 S1R possibly damaging Het
Ireb2 A T 9: 54,904,176 I755L probably benign Het
Kctd9 A G 14: 67,728,736 T101A probably damaging Het
Ltbr T C 6: 125,308,061 D292G possibly damaging Het
Med1 G A 11: 98,158,404 T507I probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Olfr705 A T 7: 106,714,378 M101K probably damaging Het
Olfr970 A C 9: 39,819,668 T10P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Pih1d1 T A 7: 45,156,329 L74* probably null Het
Prim2 T C 1: 33,514,189 T264A probably benign Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Simc1 T A 13: 54,525,190 S450R probably benign Het
Tdrd1 A T 19: 56,856,051 N796I probably damaging Het
Vmn1r214 T A 13: 23,034,792 I152N probably damaging Het
Other mutations in Fus
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02505:Fus APN 7 127981507 missense possibly damaging 0.53
IGL02622:Fus APN 7 127985622 missense probably damaging 0.99
IGL02951:Fus APN 7 127981837 unclassified probably benign
IGL03029:Fus APN 7 127985540 unclassified probably benign
R0588:Fus UTSW 7 127985574 missense probably damaging 0.99
R0674:Fus UTSW 7 127972776 unclassified probably benign
R0746:Fus UTSW 7 127985424 unclassified probably benign
R1562:Fus UTSW 7 127979922 missense probably damaging 1.00
R1733:Fus UTSW 7 127981545 missense probably benign 0.01
R2186:Fus UTSW 7 127985534 unclassified probably benign
R2200:Fus UTSW 7 127977228 missense probably damaging 0.99
R4537:Fus UTSW 7 127975915 missense probably damaging 0.99
R4981:Fus UTSW 7 127967555 start gained probably benign
R5206:Fus UTSW 7 127969797 missense unknown
R5283:Fus UTSW 7 127985547 unclassified probably benign
R5614:Fus UTSW 7 127974371 unclassified probably benign
R6182:Fus UTSW 7 127977293 missense probably damaging 0.97
R6239:Fus UTSW 7 127981434 missense possibly damaging 0.91
R6939:Fus UTSW 7 127972569 unclassified probably benign
R7130:Fus UTSW 7 127974413 missense unknown
R7340:Fus UTSW 7 127981951 utr 3 prime probably null
X0061:Fus UTSW 7 127985433 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTGGTTATGGCAATCAGGACCAGAG -3'
(R):5'- GCCATTACCAACTCCCTTGGAAGAC -3'

Sequencing Primer
(F):5'- caatcaggaccagagtggtg -3'
(R):5'- CAGGAATAGAATAGGTTTCCCCTGC -3'
Posted On2013-07-30