Incidental Mutation 'R7948:Ccdc125'
ID615992
Institutional Source Beutler Lab
Gene Symbol Ccdc125
Ensembl Gene ENSMUSG00000048924
Gene Namecoiled-coil domain containing 125
Synonyms5830436D01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7948 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location100669717-100697240 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100696402 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 496 (T496A)
Ref Sequence ENSEMBL: ENSMUSP00000058484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057325] [ENSMUST00000170347]
Predicted Effect probably benign
Transcript: ENSMUST00000057325
AA Change: T496A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058484
Gene: ENSMUSG00000048924
AA Change: T496A

DomainStartEndE-ValueType
coiled coil region 101 193 N/A INTRINSIC
coiled coil region 286 308 N/A INTRINSIC
Blast:ETS 362 447 1e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000170347
SMART Domains Protein: ENSMUSP00000130107
Gene: ENSMUSG00000048924

DomainStartEndE-ValueType
coiled coil region 101 151 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik CGGTCTAGCTGAGCAGGAGGCAGCTCAGG CGG 14: 70,157,366 probably null Het
Abca8a A T 11: 110,050,979 Y1155N probably benign Het
Adcy8 C T 15: 64,815,350 R435K possibly damaging Het
Adgrv1 C A 13: 81,559,529 V1253F probably damaging Het
Adgrv1 T C 13: 81,559,588 D1233G probably damaging Het
Baz2a G A 10: 128,125,325 R1639H possibly damaging Het
Cntnap5a A G 1: 116,580,528 M1257V probably benign Het
Cpne3 A G 4: 19,528,186 probably null Het
Cts3 T C 13: 61,566,049 E288G probably benign Het
Deup1 T C 9: 15,610,648 K74E possibly damaging Het
Epn1 T A 7: 5,089,993 Y101* probably null Het
Ercc4 A G 16: 13,130,185 D422G probably benign Het
Exoc6 A C 19: 37,576,974 N166T probably benign Het
Fam89a T C 8: 124,751,670 Y47C probably damaging Het
Fbn1 C A 2: 125,341,299 Q1753H probably damaging Het
Gal3st4 C T 5: 138,271,000 R66Q probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Golm1 C A 13: 59,664,197 probably null Het
Gtpbp3 A G 8: 71,492,586 H434R probably damaging Het
Hbegf A G 18: 36,506,699 L194S possibly damaging Het
Igsf10 A G 3: 59,331,858 S301P probably benign Het
Il9r A C 11: 32,194,486 C106W probably damaging Het
Lama5 T C 2: 180,202,201 D389G probably damaging Het
Lyst T A 13: 13,746,589 D3373E possibly damaging Het
Mkrn1 T A 6: 39,400,410 Y361F probably benign Het
Muc16 A T 9: 18,642,490 I4169N unknown Het
Myo7a C T 7: 98,075,029 G1150S probably damaging Het
Myom2 A G 8: 15,085,306 D503G probably benign Het
Nmnat3 A G 9: 98,399,482 I46V probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Nrros A T 16: 32,162,258 N17K unknown Het
Olfr33 C T 7: 102,713,688 V242I probably benign Het
Patj A T 4: 98,424,310 K295M probably damaging Het
Pax6 A G 2: 105,685,877 T167A probably benign Het
Pclo T A 5: 14,765,166 L1212* probably null Het
Peg3 T A 7: 6,708,782 Y1147F probably damaging Het
Ppp2r5c T A 12: 110,465,986 N77K probably benign Het
Prickle2 T C 6: 92,416,922 I257V possibly damaging Het
Ptprc G A 1: 138,064,576 T1132I probably benign Het
Serpinb6a G A 13: 33,923,020 S183L probably benign Het
Skiv2l2 C T 13: 112,921,762 R45Q probably benign Het
Slc6a15 T A 10: 103,404,295 M293K possibly damaging Het
Tmem131 A T 1: 36,794,148 W1749R probably damaging Het
Trpm8 T A 1: 88,374,369 Y1020* probably null Het
Ttn G T 2: 76,768,179 Y19463* probably null Het
Tubgcp5 T A 7: 55,794,248 D18E probably benign Het
Ubtd1 T A 19: 42,033,735 F149I probably benign Het
Xirp2 A G 2: 67,519,314 K3279R possibly damaging Het
Zfp236 T C 18: 82,624,415 T1117A probably damaging Het
Zfp945 A T 17: 22,852,122 C289S unknown Het
Other mutations in Ccdc125
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01888:Ccdc125 APN 13 100687102 splice site probably benign
IGL02867:Ccdc125 APN 13 100684282 splice site probably benign
R0002:Ccdc125 UTSW 13 100693606 nonsense probably null
R0014:Ccdc125 UTSW 13 100684338 missense possibly damaging 0.82
R0717:Ccdc125 UTSW 13 100690358 missense probably damaging 0.99
R1661:Ccdc125 UTSW 13 100693573 missense probably benign 0.37
R1665:Ccdc125 UTSW 13 100693573 missense probably benign 0.37
R3118:Ccdc125 UTSW 13 100690319 missense possibly damaging 0.46
R3751:Ccdc125 UTSW 13 100677951 missense possibly damaging 0.90
R4415:Ccdc125 UTSW 13 100696309 missense possibly damaging 0.83
R4838:Ccdc125 UTSW 13 100677945 missense possibly damaging 0.52
R5734:Ccdc125 UTSW 13 100687114 missense possibly damaging 0.66
R5812:Ccdc125 UTSW 13 100684304 missense probably damaging 1.00
R6031:Ccdc125 UTSW 13 100684369 splice site probably null
R6031:Ccdc125 UTSW 13 100684369 splice site probably null
R6419:Ccdc125 UTSW 13 100690326 missense probably damaging 1.00
R6456:Ccdc125 UTSW 13 100696309 missense possibly damaging 0.83
R6733:Ccdc125 UTSW 13 100694487 missense probably benign 0.04
R7183:Ccdc125 UTSW 13 100690358 missense possibly damaging 0.90
R7354:Ccdc125 UTSW 13 100677874 intron probably null
R7644:Ccdc125 UTSW 13 100678376 intron probably null
R7910:Ccdc125 UTSW 13 100682819 missense possibly damaging 0.83
R7973:Ccdc125 UTSW 13 100669823 start gained probably benign
X0027:Ccdc125 UTSW 13 100681845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCATTCAAAACGGCCTG -3'
(R):5'- GCCTACAGCGTCTTCATATTGAC -3'

Sequencing Primer
(F):5'- TTCAAAACGGCCTGGCACG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2020-01-23