Incidental Mutation 'R8066:Phip'
ID620012
Institutional Source Beutler Lab
Gene Symbol Phip
Ensembl Gene ENSMUSG00000032253
Gene Namepleckstrin homology domain interacting protein
SynonymsWdr11, 2810004D21Rik, 4632404O06Rik, Ndrp
Accession Numbers

Genbank: NM_001081216; MGI: 1932404

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8066 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location82866159-82975516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82875298 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 1607 (I1607K)
Ref Sequence ENSEMBL: ENSMUSP00000034787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034787]
Predicted Effect probably benign
Transcript: ENSMUST00000034787
AA Change: I1607K

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000034787
Gene: ENSMUSG00000032253
AA Change: I1607K

DomainStartEndE-ValueType
WD40 172 211 1.5e-8 SMART
WD40 214 253 4.1e-9 SMART
WD40 256 299 3.5e-7 SMART
WD40 310 349 1.4e-1 SMART
WD40 354 393 6.6e-10 SMART
WD40 408 452 1.4e-2 SMART
WD40 455 495 3.4e-10 SMART
WD40 498 542 6.6e-2 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 841 854 N/A INTRINSIC
low complexity region 865 877 N/A INTRINSIC
coiled coil region 881 907 N/A INTRINSIC
low complexity region 928 941 N/A INTRINSIC
BROMO 1158 1261 3.5e-11 SMART
BROMO 1318 1423 4.1e-30 SMART
low complexity region 1438 1463 N/A INTRINSIC
low complexity region 1500 1513 N/A INTRINSIC
low complexity region 1708 1721 N/A INTRINSIC
low complexity region 1752 1758 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to the insulin receptor substrate 1 protein and regulates glucose transporter translocation in skeletal muscle cells. The encoded protein may also regulate growth and survival of pancreatic beta cells. Elevated copy number of this gene may be associated with melanoma severity and the encoded protein may promote melanoma metastasis in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal and premature lethality associated with reduced body size, small myocardial cells and hepatocytes, hypoglycemia, increased insulin sensitivity, and reduced cell growth. [provided by MGI curators]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C A 4: 42,971,929 Q421K possibly damaging Het
3632451O06Rik T C 14: 49,768,523 T572A possibly damaging Het
Acap1 A G 11: 69,889,863 V177A probably benign Het
Acsm2 C A 7: 119,591,325 T517K probably damaging Het
Adam29 T G 8: 55,872,668 L250F probably benign Het
Ankrd37 T C 8: 45,997,689 D135G probably benign Het
Aspa T C 11: 73,313,546 K199E possibly damaging Het
Aurka A T 2: 172,370,418 I13K probably benign Het
Bag6 A G 17: 35,142,307 D446G unknown Het
Bcar3 A T 3: 122,524,924 I654F probably damaging Het
Ccdc188 A T 16: 18,219,194 N210Y probably damaging Het
Ccdc25 A T 14: 65,846,302 D28V possibly damaging Het
Cdc37 C T 9: 21,143,141 E63K probably benign Het
Chrm4 T A 2: 91,927,697 L150H probably damaging Het
Col5a2 A T 1: 45,413,468 probably null Het
Ctr9 T A 7: 111,033,897 Y117* probably null Het
Cyp4f37 C A 17: 32,635,073 R499S probably benign Het
Egr4 T C 6: 85,512,295 Y261C probably damaging Het
Fanca A T 8: 123,303,940 C468S unknown Het
Gart T C 16: 91,639,447 N141D probably benign Het
Get4 G A 5: 139,263,538 V126M probably damaging Het
Gja3 T C 14: 57,035,806 S370G probably benign Het
Gopc T C 10: 52,354,716 K162R probably benign Het
Grpel1 A G 5: 36,469,545 D57G probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Kcnma1 A G 14: 23,311,676 L1149P probably benign Het
Lmbrd2 G A 15: 9,172,085 R322Q probably benign Het
Lrrc59 T C 11: 94,634,600 L74P possibly damaging Het
Mcam G T 9: 44,140,960 K589N probably damaging Het
Mgea5 T C 19: 45,771,852 K289R probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,354,130 L813Q possibly damaging Het
Olfr239 T C 17: 33,199,152 F35L probably benign Het
Olfr307 A T 7: 86,335,806 C197S probably benign Het
Olfr690 C T 7: 105,329,554 V213I possibly damaging Het
Pcdhga8 A T 18: 37,726,382 I164L probably benign Het
Pck2 C A 14: 55,544,401 P251H probably benign Het
Piwil2 T C 14: 70,420,719 T220A probably benign Het
Plch1 G A 3: 63,711,057 Q686* probably null Het
Pnpla2 A G 7: 141,459,668 *487W probably null Het
Prdm14 C A 1: 13,114,316 G544C probably benign Het
Psg22 A G 7: 18,718,293 E45G possibly damaging Het
Psmb5 T C 14: 54,614,241 D249G probably benign Het
Pstpip1 A G 9: 56,126,629 I296V probably benign Het
S1pr3 T A 13: 51,419,919 *379R probably null Het
Smc3 G A 19: 53,615,145 R57H probably damaging Het
Srcap C T 7: 127,521,632 R155C probably damaging Het
Srcap T A 7: 127,540,312 H1268Q possibly damaging Het
Srgap3 A G 6: 112,771,378 F438L probably damaging Het
Svep1 A G 4: 58,113,650 V999A probably benign Het
Tchp T A 5: 114,709,411 L97Q probably benign Het
Tex46 G A 4: 136,612,954 V117M probably benign Het
Tnnc2 T A 2: 164,777,741 I102F possibly damaging Het
Trbv5 T A 6: 41,062,392 C12S probably damaging Het
Trub2 T A 2: 29,777,855 T258S possibly damaging Het
Uba3 T A 6: 97,201,921 N87I probably damaging Het
Vmn1r160 A T 7: 22,871,890 I223F probably damaging Het
Vmn1r192 G T 13: 22,187,395 Y218* probably null Het
Vmn1r8 A G 6: 57,036,434 M157V probably benign Het
Vps53 T C 11: 76,136,307 E127G probably damaging Het
Vsig10 G T 5: 117,351,784 E538D probably benign Het
Wisp2 G T 2: 163,828,942 C123F probably damaging Het
Zfp647 A T 15: 76,911,895 H188Q probably damaging Het
Other mutations in Phip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Phip APN 9 82871303 missense probably damaging 0.99
IGL01510:Phip APN 9 82913871 missense probably benign 0.01
IGL01916:Phip APN 9 82890469 missense possibly damaging 0.61
IGL02068:Phip APN 9 82945808 missense probably damaging 1.00
IGL02089:Phip APN 9 82871319 missense probably damaging 1.00
IGL02121:Phip APN 9 82893370 missense probably damaging 1.00
IGL02132:Phip APN 9 82881341 missense possibly damaging 0.91
IGL02146:Phip APN 9 82881718 missense probably benign 0.05
IGL02282:Phip APN 9 82913690 missense probably benign 0.09
IGL02341:Phip APN 9 82932883 missense probably damaging 1.00
IGL02342:Phip APN 9 82886692 missense probably damaging 1.00
IGL02470:Phip APN 9 82890454 missense possibly damaging 0.69
IGL02585:Phip APN 9 82903188 missense probably benign 0.03
IGL03271:Phip APN 9 82884824 splice site probably benign
3-1:Phip UTSW 9 82886671 missense probably damaging 1.00
R0102:Phip UTSW 9 82905792 splice site probably null
R0102:Phip UTSW 9 82905792 splice site probably null
R0137:Phip UTSW 9 82927191 splice site probably null
R0268:Phip UTSW 9 82871288 missense probably damaging 1.00
R0366:Phip UTSW 9 82926407 missense probably damaging 1.00
R0421:Phip UTSW 9 82926457 missense probably damaging 1.00
R0481:Phip UTSW 9 82876716 splice site probably benign
R0883:Phip UTSW 9 82876221 missense probably benign 0.01
R0885:Phip UTSW 9 82875395 missense probably benign 0.06
R1300:Phip UTSW 9 82876747 missense probably benign 0.00
R1434:Phip UTSW 9 82959605 missense probably damaging 0.99
R1448:Phip UTSW 9 82915423 missense possibly damaging 0.92
R1588:Phip UTSW 9 82900828 missense probably damaging 1.00
R1619:Phip UTSW 9 82871449 missense probably benign 0.20
R1658:Phip UTSW 9 82871498 missense probably benign
R1688:Phip UTSW 9 82871657 missense probably benign
R1773:Phip UTSW 9 82876189 missense probably benign
R1865:Phip UTSW 9 82945792 missense probably damaging 1.00
R1934:Phip UTSW 9 82903182 missense probably benign 0.11
R2070:Phip UTSW 9 82875299 missense probably benign
R2096:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2097:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2099:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2192:Phip UTSW 9 82871815 missense probably damaging 0.99
R2402:Phip UTSW 9 82875305 missense probably benign
R2447:Phip UTSW 9 82915399 missense probably damaging 0.99
R2504:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2507:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2508:Phip UTSW 9 82915339 missense possibly damaging 0.95
R3706:Phip UTSW 9 82900743 missense probably benign 0.02
R3829:Phip UTSW 9 82871645 missense probably benign
R3846:Phip UTSW 9 82876126 nonsense probably null
R4301:Phip UTSW 9 82959713 nonsense probably null
R4366:Phip UTSW 9 82900869 intron probably benign
R4748:Phip UTSW 9 82908869 missense probably benign 0.01
R4895:Phip UTSW 9 82959595 missense probably benign 0.20
R5001:Phip UTSW 9 82896019 splice site probably null
R5094:Phip UTSW 9 82871844 missense probably benign
R5181:Phip UTSW 9 82871190 utr 3 prime probably benign
R5194:Phip UTSW 9 82908862 missense probably benign 0.03
R5291:Phip UTSW 9 82945883 missense probably damaging 1.00
R5335:Phip UTSW 9 82900756 missense possibly damaging 0.93
R5458:Phip UTSW 9 82926500 missense probably benign 0.40
R5704:Phip UTSW 9 82871355 missense probably damaging 0.97
R5866:Phip UTSW 9 82890150 missense probably benign
R5870:Phip UTSW 9 82908677 splice site probably benign
R5890:Phip UTSW 9 82906952 missense probably benign 0.00
R6232:Phip UTSW 9 82903181 missense probably benign
R6379:Phip UTSW 9 82913857 missense probably damaging 0.98
R6653:Phip UTSW 9 82900741 nonsense probably null
R7129:Phip UTSW 9 82877300 missense probably damaging 0.98
R7290:Phip UTSW 9 82871293 missense possibly damaging 0.94
R7598:Phip UTSW 9 82905658 missense possibly damaging 0.94
R7632:Phip UTSW 9 82903190 missense probably benign
R7752:Phip UTSW 9 82890150 missense probably benign
R7827:Phip UTSW 9 82908833 missense probably benign
R7901:Phip UTSW 9 82890150 missense probably benign
R7960:Phip UTSW 9 82893348 missense probably benign 0.00
R8006:Phip UTSW 9 82890126 missense possibly damaging 0.93
R8080:Phip UTSW 9 82887609 missense probably damaging 1.00
R8135:Phip UTSW 9 82930374 missense probably benign 0.09
R8347:Phip UTSW 9 82908763 missense probably benign 0.02
R8459:Phip UTSW 9 82876053 missense probably benign
R8705:Phip UTSW 9 82893559 missense probably damaging 0.99
R8706:Phip UTSW 9 82905712 missense possibly damaging 0.89
R8743:Phip UTSW 9 82927087 missense probably benign 0.18
R8801:Phip UTSW 9 82876252 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CCAGCGCATTCAAGCATTAC -3'
(R):5'- GACATTCCAAAGCCTTGAGC -3'

Sequencing Primer
(F):5'- TCTTAAATTGACACCCCCAAAAGG -3'
(R):5'- GCCTTGAGCACACTTTCCAG -3'
Posted On2020-01-23