Incidental Mutation 'R8090:Ifit2'
ID629923
Institutional Source Beutler Lab
Gene Symbol Ifit2
Ensembl Gene ENSMUSG00000045932
Gene Nameinterferon-induced protein with tetratricopeptide repeats 2
SynonymsIfi54
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8090 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location34550694-34576419 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34573262 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 67 (N67K)
Ref Sequence ENSEMBL: ENSMUSP00000099890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102826] [ENSMUST00000149829]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102826
AA Change: N67K

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099890
Gene: ENSMUSG00000045932
AA Change: N67K

DomainStartEndE-ValueType
Pfam:TPR_2 95 127 4e-4 PFAM
Pfam:TPR_8 95 127 3.8e-4 PFAM
Blast:TPR 138 171 7e-11 BLAST
Blast:TPR 172 208 2e-9 BLAST
low complexity region 211 222 N/A INTRINSIC
Pfam:TPR_19 225 286 4e-8 PFAM
low complexity region 396 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149829
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 92.1%
Validation Efficiency 99% (73/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susuceptibility to VSV infection with increased lethality and brain viral titer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat T C 11: 116,596,191 C75R probably damaging Het
Ackr2 A G 9: 121,908,979 D140G possibly damaging Het
Adgrv1 C A 13: 81,448,834 probably null Het
Arpp21 A G 9: 112,116,701 L593S unknown Het
Atn1 G A 6: 124,745,341 P850S unknown Het
Capn13 G A 17: 73,382,854 S54L probably benign Het
Cd1d2 C T 3: 86,986,657 P5S possibly damaging Het
Cgn A G 3: 94,779,953 V13A probably damaging Het
Clint1 T C 11: 45,887,440 V136A probably damaging Het
Cox5a T A 9: 57,529,063 L66M probably damaging Het
Crb2 G T 2: 37,795,491 C1205F probably damaging Het
Ddx3y C T Y: 1,264,897 S519N probably benign Het
Defb50 G A 8: 21,831,071 G26S probably damaging Het
Dock8 T C 19: 25,154,242 L1112P probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Gm9573 G C 17: 35,621,725 T523S unknown Het
Gm9837 A G 11: 53,470,238 S50P unknown Het
Gon4l A G 3: 88,892,624 I859V probably damaging Het
Grin3a A T 4: 49,714,224 D840E probably damaging Het
Il17re G A 6: 113,462,289 W53* probably null Het
Kbtbd4 A T 2: 90,905,839 probably benign Het
Krt25 T A 11: 99,316,590 probably null Het
Krt26 T C 11: 99,336,489 M171V probably benign Het
Lrba T C 3: 86,348,489 L1046S probably benign Het
Lrp2 G T 2: 69,464,745 P3410T possibly damaging Het
Madd T C 2: 91,155,623 K1241R probably benign Het
Mcm8 T G 2: 132,831,649 S402A probably benign Het
Mpc1 A C 17: 8,296,873 Q74H probably benign Het
Mroh4 A G 15: 74,624,701 V279A probably benign Het
Ndufs2 A T 1: 171,236,678 H380Q probably damaging Het
Nkx2-6 T C 14: 69,172,016 L72P possibly damaging Het
Nme6 T A 9: 109,841,951 L73* probably null Het
Odf2l G T 3: 145,127,035 A85S probably damaging Het
Olfr616 A T 7: 103,564,841 I146K probably benign Het
P4ha3 T A 7: 100,300,652 C109S probably damaging Het
Plpp6 C T 19: 28,964,871 Q291* probably null Het
Plxnd1 G A 6: 115,956,617 A1855V probably damaging Het
Ptcd1 A T 5: 145,159,535 H249Q possibly damaging Het
Rnf149 C A 1: 39,577,223 A18S unknown Het
Scara5 C T 14: 65,742,137 R368* probably null Het
Sfmbt2 G A 2: 10,461,379 D342N probably benign Het
Shank3 T A 15: 89,505,458 probably null Het
Slc22a27 A G 19: 7,865,736 probably null Het
Srgap3 G T 6: 112,781,035 Y170* probably null Het
Szt2 A T 4: 118,387,002 probably null Het
Tbccd1 A G 16: 22,842,055 S4P probably benign Het
Tcf20 A G 15: 82,856,006 S415P probably damaging Het
Tdrd9 T C 12: 112,015,935 S487P probably damaging Het
Trim26 A G 17: 36,856,748 Q300R possibly damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Yif1b A G 7: 29,244,301 N93S probably benign Het
Zdhhc22 C A 12: 86,983,620 V185F probably benign Het
Zfp638 G T 6: 83,929,819 S322I probably damaging Het
Zfp786 T A 6: 47,820,009 H665L probably damaging Het
Zfp799 C T 17: 32,820,975 V106I probably benign Het
Other mutations in Ifit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ifit2 APN 19 34573302 missense probably damaging 1.00
IGL02261:Ifit2 APN 19 34574224 missense probably damaging 1.00
IGL02375:Ifit2 APN 19 34574337 missense probably benign 0.01
Pushup UTSW 19 34574045 missense probably benign 0.38
R0017:Ifit2 UTSW 19 34573573 missense probably damaging 1.00
R0017:Ifit2 UTSW 19 34573573 missense probably damaging 1.00
R0682:Ifit2 UTSW 19 34573612 missense probably benign 0.13
R0927:Ifit2 UTSW 19 34573584 missense probably benign 0.03
R1462:Ifit2 UTSW 19 34573186 missense probably null 0.12
R1462:Ifit2 UTSW 19 34573186 missense probably null 0.12
R1526:Ifit2 UTSW 19 34573202 missense probably benign 0.00
R2084:Ifit2 UTSW 19 34573350 missense probably damaging 1.00
R3971:Ifit2 UTSW 19 34574041 missense probably benign 0.00
R4008:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4010:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4011:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4359:Ifit2 UTSW 19 34573144 missense possibly damaging 0.85
R5179:Ifit2 UTSW 19 34573576 missense probably damaging 1.00
R5240:Ifit2 UTSW 19 34574396 missense probably benign 0.02
R5424:Ifit2 UTSW 19 34574058 missense probably benign 0.19
R5528:Ifit2 UTSW 19 34573537 missense possibly damaging 0.63
R6605:Ifit2 UTSW 19 34573497 nonsense probably null
R7172:Ifit2 UTSW 19 34573494 missense probably benign 0.24
R7424:Ifit2 UTSW 19 34573198 missense probably benign 0.37
X0023:Ifit2 UTSW 19 34574250 missense possibly damaging 0.59
X0064:Ifit2 UTSW 19 34573923 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGTCACTGGAGAGCAATCTGC -3'
(R):5'- TCACAGTCAAGAGCAGGATTCTC -3'

Sequencing Primer
(F):5'- TCTGCGACAGCTAAAATGCCATTTC -3'
(R):5'- GCTGGAAAACTTCTTGCAGACCTG -3'
Posted On2020-06-30