Incidental Mutation 'R8103:Vmn2r65'
ID630576
Institutional Source Beutler Lab
Gene Symbol Vmn2r65
Ensembl Gene ENSMUSG00000066372
Gene Namevomeronasal 2, receptor 65
SynonymsENSMUSG00000070600
MMRRC Submission
Accession Numbers

Genbank: NM_001105180; MGI: 3642776

Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8103 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location84940169-84964009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84946711 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 255 (I255T)
Ref Sequence ENSEMBL: ENSMUSP00000036551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044583]
Predicted Effect probably damaging
Transcript: ENSMUST00000044583
AA Change: I255T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036551
Gene: ENSMUSG00000066372
AA Change: I255T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 435 5.6e-41 PFAM
Pfam:NCD3G 501 553 1.3e-21 PFAM
Pfam:7tm_3 584 821 2.3e-53 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.4%
Validation Efficiency 100% (83/83)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,834 D216G probably benign Het
4930430F08Rik C A 10: 100,577,248 V178F probably benign Het
9030624J02Rik T C 7: 118,743,632 S47P probably benign Het
Abcg5 A T 17: 84,658,528 I640K possibly damaging Het
Acadvl T C 11: 70,014,342 K128R probably benign Het
Angptl7 T A 4: 148,496,561 N259I probably damaging Het
Ankrd35 A G 3: 96,679,681 K104R possibly damaging Het
Antxr1 T C 6: 87,188,216 N413S probably damaging Het
Arhgap26 A G 18: 39,371,124 T376A Het
Atf6b T G 17: 34,653,975 S622A probably damaging Het
Atp5h T A 11: 115,416,025 Y115F possibly damaging Het
Axin2 T C 11: 108,931,543 L307P probably damaging Het
B4galnt4 C T 7: 141,064,651 T153M possibly damaging Het
Brd8 A G 18: 34,607,178 V604A probably benign Het
Ccser2 T C 14: 36,896,283 Y765C probably damaging Het
Cdh26 A G 2: 178,468,213 D433G probably damaging Het
Cep85l T G 10: 53,299,324 probably null Het
Col23a1 T A 11: 51,570,187 probably null Het
Col7a1 A G 9: 108,975,384 D2261G unknown Het
Comp C A 8: 70,381,286 N650K probably damaging Het
Copb1 A G 7: 114,234,967 M476T possibly damaging Het
Dapk1 T A 13: 60,749,195 S743T probably damaging Het
Ddx39 A G 8: 83,724,476 probably null Het
Dgkb A G 12: 38,136,581 H243R probably damaging Het
Dsg1c T G 18: 20,283,114 Y691D probably damaging Het
Duox2 C T 2: 122,287,054 S933N probably benign Het
Ece1 T C 4: 137,913,822 S19P probably benign Het
Edem1 G A 6: 108,852,563 E548K probably damaging Het
Fpr-rs6 A G 17: 20,182,577 V174A possibly damaging Het
Fyco1 A T 9: 123,829,388 N574K probably benign Het
Glb1l2 T A 9: 26,765,684 M551L probably benign Het
Gm3376 C T Y: 3,776,675 T104I possibly damaging Het
Gm5580 C T 6: 116,551,507 T115I probably damaging Het
Gm7694 G T 1: 170,302,715 P38Q probably damaging Het
Grip1 A G 10: 119,978,535 T324A probably benign Het
Htr3b A G 9: 48,946,549 V131A possibly damaging Het
Igfbp1 T C 11: 7,198,106 C50R probably damaging Het
Il5ra A G 6: 106,715,650 I378T possibly damaging Het
Ints11 T C 4: 155,888,230 L504P possibly damaging Het
Iqca A T 1: 90,059,608 I74N Het
Kbtbd12 C T 6: 88,618,681 A56T probably damaging Het
Kcnq5 T C 1: 21,479,396 N369S possibly damaging Het
Kmt5b A G 19: 3,815,381 D815G probably benign Het
Lnpk T C 2: 74,522,255 Q361R probably benign Het
Mep1b T C 18: 21,089,385 I277T possibly damaging Het
Naip6 G A 13: 100,301,343 T385I probably benign Het
Narfl A G 17: 25,777,421 T135A probably benign Het
Npepl1 A T 2: 174,111,209 I95F probably benign Het
Nxpe4 T C 9: 48,392,720 F36L probably benign Het
Olfr129 A T 17: 38,055,012 C185S probably damaging Het
Olfr393 C T 11: 73,847,909 C72Y probably damaging Het
Optn C A 2: 5,040,202 C243F probably damaging Het
Paqr7 T C 4: 134,507,510 V226A probably benign Het
Pcdh12 T A 18: 38,282,159 I638F probably damaging Het
Pfas T C 11: 68,992,293 T722A probably damaging Het
Pkhd1 T A 1: 20,200,757 I3191F probably damaging Het
Plxnc1 T A 10: 94,871,082 H531L probably benign Het
Pom121l2 A G 13: 21,982,374 T272A probably benign Het
Pparg T C 6: 115,473,141 V367A possibly damaging Het
Psen2 A T 1: 180,240,791 M99K probably damaging Het
Ranbp10 T C 8: 105,772,547 T536A probably benign Het
Rbfox2 G T 15: 77,099,454 P284T probably damaging Het
Rere G A 4: 150,617,339 R25H probably damaging Het
Rhpn1 T A 15: 75,709,266 L119Q probably null Het
Rreb1 A G 13: 37,941,701 T1328A probably benign Het
Sept11 A T 5: 93,161,148 probably null Het
Skida1 T A 2: 18,047,738 Q201L probably benign Het
Sptan1 T A 2: 30,020,043 I1805N probably damaging Het
Stard13 T A 5: 151,046,970 Q853L possibly damaging Het
Susd1 T A 4: 59,365,916 probably null Het
Szt2 T A 4: 118,387,864 Q1158H possibly damaging Het
Tbcc A C 17: 46,891,120 D144A probably benign Het
Tsn A G 1: 118,304,707 I146T probably benign Het
Umad1 A T 6: 8,427,121 T99S probably damaging Het
Vcan T A 13: 89,657,658 E3261V probably damaging Het
Vcan C A 13: 89,703,320 E1174* probably null Het
Vmn2r100 C A 17: 19,531,153 probably null Het
Wdr70 A G 15: 7,977,131 L313P possibly damaging Het
Ythdf2 C A 4: 132,204,778 R357L probably damaging Het
Zfp523 T C 17: 28,201,293 C262R probably damaging Het
Zfp553 T C 7: 127,236,764 V497A probably benign Het
Zhx1 A G 15: 58,053,266 L528S probably benign Het
Other mutations in Vmn2r65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Vmn2r65 APN 7 84943553 missense probably damaging 0.99
IGL01104:Vmn2r65 APN 7 84940788 missense possibly damaging 0.93
IGL01154:Vmn2r65 APN 7 84943521 missense probably benign 0.00
IGL01453:Vmn2r65 APN 7 84940500 missense probably damaging 1.00
IGL01675:Vmn2r65 APN 7 84947379 missense probably benign 0.00
IGL01748:Vmn2r65 APN 7 84940299 missense probably damaging 1.00
IGL01997:Vmn2r65 APN 7 84940770 missense probably damaging 1.00
IGL02527:Vmn2r65 APN 7 84946516 missense possibly damaging 0.82
IGL02617:Vmn2r65 APN 7 84940341 missense probably damaging 1.00
IGL02676:Vmn2r65 APN 7 84940173 missense possibly damaging 0.86
IGL03084:Vmn2r65 APN 7 84943146 missense probably damaging 1.00
A4554:Vmn2r65 UTSW 7 84946583 missense probably damaging 0.96
PIT4651001:Vmn2r65 UTSW 7 84946253 missense probably benign 0.12
R0322:Vmn2r65 UTSW 7 84946548 missense probably benign 0.01
R0453:Vmn2r65 UTSW 7 84946234 missense probably benign 0.03
R0862:Vmn2r65 UTSW 7 84943645 missense probably benign 0.00
R1392:Vmn2r65 UTSW 7 84947416 missense probably benign 0.14
R1392:Vmn2r65 UTSW 7 84947416 missense probably benign 0.14
R1508:Vmn2r65 UTSW 7 84940678 missense probably benign 0.00
R1687:Vmn2r65 UTSW 7 84940818 missense probably benign 0.02
R1876:Vmn2r65 UTSW 7 84946297 missense probably damaging 1.00
R2136:Vmn2r65 UTSW 7 84943573 missense probably damaging 0.96
R2259:Vmn2r65 UTSW 7 84940911 missense possibly damaging 0.86
R2338:Vmn2r65 UTSW 7 84940843 missense possibly damaging 0.86
R2880:Vmn2r65 UTSW 7 84963886 missense probably damaging 1.00
R3410:Vmn2r65 UTSW 7 84946688 missense probably benign 0.00
R3411:Vmn2r65 UTSW 7 84946688 missense probably benign 0.00
R3770:Vmn2r65 UTSW 7 84940415 missense probably damaging 1.00
R3800:Vmn2r65 UTSW 7 84940530 missense possibly damaging 0.93
R3850:Vmn2r65 UTSW 7 84946651 missense probably benign 0.00
R4105:Vmn2r65 UTSW 7 84946483 missense probably benign 0.03
R4568:Vmn2r65 UTSW 7 84947469 missense probably damaging 1.00
R4677:Vmn2r65 UTSW 7 84963874 missense possibly damaging 0.55
R4768:Vmn2r65 UTSW 7 84947394 missense probably damaging 1.00
R4778:Vmn2r65 UTSW 7 84943593 missense possibly damaging 0.47
R5057:Vmn2r65 UTSW 7 84940611 missense probably damaging 1.00
R5279:Vmn2r65 UTSW 7 84940641 missense probably damaging 1.00
R5280:Vmn2r65 UTSW 7 84946334 missense probably damaging 0.99
R5394:Vmn2r65 UTSW 7 84946654 missense probably benign 0.04
R5487:Vmn2r65 UTSW 7 84946321 missense possibly damaging 0.76
R5580:Vmn2r65 UTSW 7 84947594 missense probably damaging 0.99
R5638:Vmn2r65 UTSW 7 84940839 missense probably damaging 1.00
R5673:Vmn2r65 UTSW 7 84947407 missense probably benign 0.23
R5688:Vmn2r65 UTSW 7 84940692 missense probably benign 0.00
R5935:Vmn2r65 UTSW 7 84943661 missense probably benign 0.00
R6354:Vmn2r65 UTSW 7 84940366 missense probably benign 0.35
R6372:Vmn2r65 UTSW 7 84940653 missense probably damaging 1.00
R6924:Vmn2r65 UTSW 7 84963990 missense probably benign 0.20
R7021:Vmn2r65 UTSW 7 84947379 missense probably benign 0.00
R7195:Vmn2r65 UTSW 7 84943139 critical splice donor site probably null
R7422:Vmn2r65 UTSW 7 84946361 missense probably damaging 0.99
R7654:Vmn2r65 UTSW 7 84941053 missense probably damaging 1.00
R7686:Vmn2r65 UTSW 7 84940536 missense probably damaging 0.99
R7691:Vmn2r65 UTSW 7 84943643 missense probably benign 0.30
R7798:Vmn2r65 UTSW 7 84946322 missense probably benign 0.00
R7798:Vmn2r65 UTSW 7 84946984 missense probably damaging 1.00
R8272:Vmn2r65 UTSW 7 84947609 missense probably benign 0.02
R8303:Vmn2r65 UTSW 7 84940183 nonsense probably null
R8354:Vmn2r65 UTSW 7 84940194 missense possibly damaging 0.73
X0067:Vmn2r65 UTSW 7 84940905 missense probably benign 0.04
Z1088:Vmn2r65 UTSW 7 84943265 critical splice acceptor site probably null
Z1177:Vmn2r65 UTSW 7 84941026 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCAGGAATCTTAGAATGGGGATGTG -3'
(R):5'- TTTCTGACCCTGGCCATGAC -3'

Sequencing Primer
(F):5'- GTGAGGTGGTAATCCAGA -3'
(R):5'- CCATGACGGCCTTAGTGG -3'
Posted On2020-06-30