Incidental Mutation 'R7195:Vmn2r65'
ID559856
Institutional Source Beutler Lab
Gene Symbol Vmn2r65
Ensembl Gene ENSMUSG00000066372
Gene Namevomeronasal 2, receptor 65
SynonymsENSMUSG00000070600
MMRRC Submission
Accession Numbers

Genbank: NM_001105180; MGI: 3642776

Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7195 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location84940169-84964009 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 84943139 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044583]
Predicted Effect probably null
Transcript: ENSMUST00000044583
SMART Domains Protein: ENSMUSP00000036551
Gene: ENSMUSG00000066372

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 435 5.6e-41 PFAM
Pfam:NCD3G 501 553 1.3e-21 PFAM
Pfam:7tm_3 584 821 2.3e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,288,416 probably null Het
4930563D23Rik C T 16: 92,321,149 V84M probably damaging Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Adam39 A T 8: 40,824,775 R68* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Cep19 A G 16: 32,107,086 D104G probably damaging Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
D7Ertd443e A G 7: 134,295,122 V513A probably damaging Het
Egfr C T 11: 16,868,162 P228L probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Itih4 T C 14: 30,899,475 S832P probably damaging Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Map4k4 T C 1: 40,019,669 Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Npas1 T C 7: 16,474,808 E48G probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr1215 G A 2: 89,001,731 L186F Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Ptpn9 T A 9: 57,022,249 H83Q probably benign Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Suz12 T A 11: 80,013,483 F239L probably damaging Het
Tbx3 A G 5: 119,675,583 Y248C probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Ubxn11 A C 4: 134,126,415 I398L possibly damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,548 D133G probably benign Het
Zcchc14 T C 8: 121,608,461 I307V unknown Het
Zfp933 G A 4: 147,826,179 T320I probably benign Het
Other mutations in Vmn2r65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Vmn2r65 APN 7 84943553 missense probably damaging 0.99
IGL01104:Vmn2r65 APN 7 84940788 missense possibly damaging 0.93
IGL01154:Vmn2r65 APN 7 84943521 missense probably benign 0.00
IGL01453:Vmn2r65 APN 7 84940500 missense probably damaging 1.00
IGL01675:Vmn2r65 APN 7 84947379 missense probably benign 0.00
IGL01748:Vmn2r65 APN 7 84940299 missense probably damaging 1.00
IGL01997:Vmn2r65 APN 7 84940770 missense probably damaging 1.00
IGL02527:Vmn2r65 APN 7 84946516 missense possibly damaging 0.82
IGL02617:Vmn2r65 APN 7 84940341 missense probably damaging 1.00
IGL02676:Vmn2r65 APN 7 84940173 missense possibly damaging 0.86
IGL03084:Vmn2r65 APN 7 84943146 missense probably damaging 1.00
A4554:Vmn2r65 UTSW 7 84946583 missense probably damaging 0.96
PIT4651001:Vmn2r65 UTSW 7 84946253 missense probably benign 0.12
R0322:Vmn2r65 UTSW 7 84946548 missense probably benign 0.01
R0453:Vmn2r65 UTSW 7 84946234 missense probably benign 0.03
R0862:Vmn2r65 UTSW 7 84943645 missense probably benign 0.00
R1392:Vmn2r65 UTSW 7 84947416 missense probably benign 0.14
R1392:Vmn2r65 UTSW 7 84947416 missense probably benign 0.14
R1508:Vmn2r65 UTSW 7 84940678 missense probably benign 0.00
R1687:Vmn2r65 UTSW 7 84940818 missense probably benign 0.02
R1876:Vmn2r65 UTSW 7 84946297 missense probably damaging 1.00
R2136:Vmn2r65 UTSW 7 84943573 missense probably damaging 0.96
R2259:Vmn2r65 UTSW 7 84940911 missense possibly damaging 0.86
R2338:Vmn2r65 UTSW 7 84940843 missense possibly damaging 0.86
R2880:Vmn2r65 UTSW 7 84963886 missense probably damaging 1.00
R3410:Vmn2r65 UTSW 7 84946688 missense probably benign 0.00
R3411:Vmn2r65 UTSW 7 84946688 missense probably benign 0.00
R3770:Vmn2r65 UTSW 7 84940415 missense probably damaging 1.00
R3800:Vmn2r65 UTSW 7 84940530 missense possibly damaging 0.93
R3850:Vmn2r65 UTSW 7 84946651 missense probably benign 0.00
R4105:Vmn2r65 UTSW 7 84946483 missense probably benign 0.03
R4568:Vmn2r65 UTSW 7 84947469 missense probably damaging 1.00
R4677:Vmn2r65 UTSW 7 84963874 missense possibly damaging 0.55
R4768:Vmn2r65 UTSW 7 84947394 missense probably damaging 1.00
R4778:Vmn2r65 UTSW 7 84943593 missense possibly damaging 0.47
R5057:Vmn2r65 UTSW 7 84940611 missense probably damaging 1.00
R5279:Vmn2r65 UTSW 7 84940641 missense probably damaging 1.00
R5280:Vmn2r65 UTSW 7 84946334 missense probably damaging 0.99
R5394:Vmn2r65 UTSW 7 84946654 missense probably benign 0.04
R5487:Vmn2r65 UTSW 7 84946321 missense possibly damaging 0.76
R5580:Vmn2r65 UTSW 7 84947594 missense probably damaging 0.99
R5638:Vmn2r65 UTSW 7 84940839 missense probably damaging 1.00
R5673:Vmn2r65 UTSW 7 84947407 missense probably benign 0.23
R5688:Vmn2r65 UTSW 7 84940692 missense probably benign 0.00
R5935:Vmn2r65 UTSW 7 84943661 missense probably benign 0.00
R6354:Vmn2r65 UTSW 7 84940366 missense probably benign 0.35
R6372:Vmn2r65 UTSW 7 84940653 missense probably damaging 1.00
R6924:Vmn2r65 UTSW 7 84963990 missense probably benign 0.20
R7021:Vmn2r65 UTSW 7 84947379 missense probably benign 0.00
R7422:Vmn2r65 UTSW 7 84946361 missense probably damaging 0.99
R7654:Vmn2r65 UTSW 7 84941053 missense probably damaging 1.00
R7686:Vmn2r65 UTSW 7 84940536 missense probably damaging 0.99
R7691:Vmn2r65 UTSW 7 84943643 missense probably benign 0.30
R7798:Vmn2r65 UTSW 7 84946322 missense probably benign 0.00
R7798:Vmn2r65 UTSW 7 84946984 missense probably damaging 1.00
R8103:Vmn2r65 UTSW 7 84946711 missense probably damaging 1.00
R8272:Vmn2r65 UTSW 7 84947609 missense probably benign 0.02
R8303:Vmn2r65 UTSW 7 84940183 nonsense probably null
X0067:Vmn2r65 UTSW 7 84940905 missense probably benign 0.04
Z1088:Vmn2r65 UTSW 7 84943265 critical splice acceptor site probably null
Z1177:Vmn2r65 UTSW 7 84941026 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCACTGGTCCTGAGATTGAG -3'
(R):5'- GAAGTGGGTCAAACTCTTTCTAC -3'

Sequencing Primer
(F):5'- TCACATTGAAAATTCCCCTGGTAC -3'
(R):5'- GTGGGTCAAACTCTTTCTACTAACAC -3'
Posted On2019-06-26