Incidental Mutation 'R0723:Hoxd9'
ID63589
Institutional Source Beutler Lab
Gene Symbol Hoxd9
Ensembl Gene ENSMUSG00000043342
Gene Namehomeobox D9
SynonymsHox-5.2, Hox-4.4
MMRRC Submission 038905-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0723 (G1)
Quality Score81
Status Validated
Chromosome2
Chromosomal Location74697727-74700208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74698828 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 258 (D258V)
Ref Sequence ENSEMBL: ENSMUSP00000058490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059272] [ENSMUST00000061745]
Predicted Effect probably damaging
Transcript: ENSMUST00000059272
AA Change: D258V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058490
Gene: ENSMUSG00000043342
AA Change: D258V

DomainStartEndE-ValueType
Pfam:Hox9_act 1 126 2e-47 PFAM
low complexity region 155 176 N/A INTRINSIC
low complexity region 208 225 N/A INTRINSIC
low complexity region 248 256 N/A INTRINSIC
HOX 272 334 6.25e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061745
SMART Domains Protein: ENSMUSP00000062412
Gene: ENSMUSG00000050368

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
HOX 266 328 3.3e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126966
SMART Domains Protein: ENSMUSP00000133930
Gene: ENSMUSG00000086077

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198895
Meta Mutation Damage Score 0.7543 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located at 2q31-2q37 chromosome regions. Deletions that removed the entire HOXD gene cluster or 5' end of this cluster have been associated with severe limb and genital abnormalities. The exact role of this gene has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit anterior transformation of lumbar, sacral, and caudal vertebrae with abnormal humerus morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,691 N341K probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4931423N10Rik T C 2: 23,256,924 probably benign Het
8030411F24Rik T C 2: 148,783,362 I72T probably damaging Het
Acbd5 T G 2: 23,069,596 V54G probably damaging Het
Acin1 A T 14: 54,665,451 S255T probably damaging Het
Adcy2 A G 13: 68,999,129 L56P probably damaging Het
Akap6 G T 12: 53,141,902 C2033F probably damaging Het
Ano5 A G 7: 51,587,758 I777V probably benign Het
Arhgef28 A G 13: 97,939,479 V1349A probably benign Het
Bank1 T C 3: 136,054,403 probably null Het
C2cd5 T C 6: 143,041,555 probably benign Het
Cadps2 A G 6: 23,287,698 V1161A probably damaging Het
Car8 A T 4: 8,169,703 D268E probably benign Het
Ckap5 T A 2: 91,555,331 S175T probably damaging Het
Clk4 T A 11: 51,275,493 Y67* probably null Het
Copg2 T C 6: 30,815,982 I473V possibly damaging Het
Cyp2s1 C T 7: 25,809,548 V43I probably benign Het
Ddx54 A G 5: 120,623,638 D493G probably benign Het
Efemp2 T C 19: 5,480,050 S140P probably damaging Het
Fam214a G A 9: 75,009,451 G444E probably damaging Het
Fat1 C A 8: 45,026,749 T2944K probably damaging Het
Fgfr1 T A 8: 25,557,768 D43E probably damaging Het
Fry G A 5: 150,496,360 A996T probably damaging Het
Fyb2 G A 4: 105,015,866 V784I probably benign Het
Gm6507 T A 6: 89,185,162 noncoding transcript Het
Gm7964 T C 7: 83,756,166 noncoding transcript Het
Gucy2c T C 6: 136,727,801 probably null Het
Hdac10 A T 15: 89,126,418 L259Q probably damaging Het
Hs3st3b1 T C 11: 63,921,575 T105A probably benign Het
Hsd17b7 A G 1: 169,956,026 L271P probably damaging Het
Ifnlr1 T A 4: 135,701,213 probably benign Het
Kif22 A T 7: 127,033,906 M121K probably damaging Het
Kl G A 5: 150,953,101 D129N probably damaging Het
Mettl13 A T 1: 162,534,430 I648N probably damaging Het
Mlh1 C T 9: 111,271,472 R18H probably damaging Het
Mtmr14 T C 6: 113,270,512 probably benign Het
Myo15 C A 11: 60,478,977 N854K possibly damaging Het
Myo1h T C 5: 114,319,680 I84T probably benign Het
Myo9a A T 9: 59,871,100 S1380C probably benign Het
Myof A G 19: 37,981,260 V318A probably damaging Het
N4bp2l2 A G 5: 150,662,432 S28P probably damaging Het
Narfl G A 17: 25,781,821 V406M probably damaging Het
Nbr1 C T 11: 101,576,319 Q570* probably null Het
Nhp2 C T 11: 51,619,923 Q36* probably null Het
Olfr23 T G 11: 73,940,270 V8G probably benign Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Poc1b T A 10: 99,129,595 W129R probably damaging Het
Rapgef2 C T 3: 79,079,174 E1018K probably benign Het
Rgs12 T C 5: 35,024,366 probably benign Het
Rufy2 G A 10: 62,998,094 V280I probably benign Het
Snx2 A G 18: 53,210,372 I281V probably benign Het
Spag5 C A 11: 78,319,584 probably benign Het
Stxbp5 A T 10: 9,768,873 I961N probably damaging Het
Tet2 T C 3: 133,467,284 E1739G probably benign Het
Tmod2 A G 9: 75,595,055 F50S possibly damaging Het
Tnfsf13b T G 8: 10,007,166 probably null Het
Ttn T C 2: 76,786,335 K16525E possibly damaging Het
Txnrd2 T C 16: 18,440,879 probably benign Het
Ubr1 A T 2: 120,881,101 Y1437* probably null Het
Vwf C A 6: 125,566,262 D170E probably benign Het
Wdr95 C G 5: 149,574,048 I230M probably damaging Het
Xirp2 C T 2: 67,512,215 S1600F probably damaging Het
Zfp12 A G 5: 143,244,883 K322E probably damaging Het
Other mutations in Hoxd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3743:Hoxd9 UTSW 2 74698366 missense probably damaging 0.99
R4155:Hoxd9 UTSW 2 74699323 missense probably benign 0.15
R4261:Hoxd9 UTSW 2 74695687 unclassified probably benign
R5794:Hoxd9 UTSW 2 74699273 missense probably damaging 1.00
R6114:Hoxd9 UTSW 2 74699365 missense probably damaging 1.00
R6197:Hoxd9 UTSW 2 74698822 missense probably damaging 0.99
R6248:Hoxd9 UTSW 2 74698636 missense probably benign 0.09
R6268:Hoxd9 UTSW 2 74698089 missense probably damaging 1.00
R6717:Hoxd9 UTSW 2 74698389 missense probably benign 0.01
R6809:Hoxd9 UTSW 2 74699246 missense probably damaging 1.00
R7183:Hoxd9 UTSW 2 74698365 missense possibly damaging 0.59
R7254:Hoxd9 UTSW 2 74698374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATTCCCGTGCAACTCGTTCC -3'
(R):5'- AAAAGCCTTAATGCCCGCGCTC -3'

Sequencing Primer
(F):5'- TCCGAGCCCTCAGCTTG -3'
(R):5'- GCTCTGTTTACCGTACAAACCG -3'
Posted On2013-07-30