Incidental Mutation 'R8281:Mob3c'
List |< first << previous [record 31 of 48] next >> last >|
ID638187
Institutional Source Beutler Lab
Gene Symbol Mob3c
Ensembl Gene ENSMUSG00000028709
Gene NameMOB kinase activator 3C
SynonymsMOB3C, Mobkl2c, D130076I06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R8281 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location115828092-115836185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115831438 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 56 (I56T)
Ref Sequence ENSEMBL: ENSMUSP00000030477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030477] [ENSMUST00000148409]
Predicted Effect probably benign
Transcript: ENSMUST00000030477
AA Change: I56T

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030477
Gene: ENSMUSG00000028709
AA Change: I56T

DomainStartEndE-ValueType
Mob1_phocein 33 207 3.04e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148409
AA Change: I56T

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123611
Gene: ENSMUSG00000028709
AA Change: I56T

DomainStartEndE-ValueType
Pfam:Mob1_phocein 31 90 1.3e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to the yeast Mob1 protein. Yeast Mob1 binds Mps1p, a protein kinase essential for spindle pole body duplication and mitotic checkpoint regulation. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T A 5: 24,549,010 H417L probably benign Het
Adam7 G A 14: 68,507,885 T630I possibly damaging Het
Adgrf3 T C 5: 30,197,303 S576G possibly damaging Het
Asxl1 A G 2: 153,399,401 R625G probably damaging Het
Atp1a1 A G 3: 101,579,624 F916L probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
B230359F08Rik A G 14: 53,795,461 R3G possibly damaging Het
Chd9 A G 8: 91,036,597 D2350G probably damaging Het
Cic G A 7: 25,271,824 V327I probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Crym T A 7: 120,202,027 probably benign Het
Cyp3a13 G C 5: 137,894,297 S495C probably benign Het
D5Ertd579e A T 5: 36,613,320 F137I Het
Dip2a T C 10: 76,276,604 T1087A probably damaging Het
Drc7 G A 8: 95,062,177 E288K possibly damaging Het
Epb41l4a T C 18: 33,878,945 E174G probably damaging Het
Ern2 T C 7: 122,170,260 R848G probably damaging Het
F13b G T 1: 139,510,951 R364S probably benign Het
F2rl1 A G 13: 95,514,077 L99P probably damaging Het
Fam193a C A 5: 34,443,436 N171K unknown Het
Fst A G 13: 114,455,241 S201P probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm597 C T 1: 28,778,144 C269Y possibly damaging Het
Gm6460 T A 5: 11,597,679 M128K probably damaging Het
Gm8232 A G 14: 44,437,091 I182V Het
Gm8251 T G 1: 44,056,538 D1800A possibly damaging Het
Kalrn C T 16: 34,035,061 W1956* probably null Het
Klk1b16 A G 7: 44,141,547 M258V probably benign Het
Lta4h G T 10: 93,453,594 D29Y probably damaging Het
March7 C T 2: 60,234,529 S383L probably benign Het
Msl2 T C 9: 101,101,695 S423P probably benign Het
Otop3 T C 11: 115,345,075 I511T possibly damaging Het
Pbld2 T G 10: 63,048,026 L90R probably damaging Het
Pcdh8 A G 14: 79,769,479 V548A probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch2 T A 4: 155,006,973 M228L probably benign Het
Prkdc T C 16: 15,705,253 C1180R probably damaging Het
Rasl2-9 A T 7: 5,125,352 L193* probably null Het
Rbp3 A G 14: 33,956,363 K756R probably benign Het
Rp1 T C 1: 4,347,916 E991G probably damaging Het
Slc12a7 G A 13: 73,790,677 R191H probably damaging Het
Spaca6 A G 17: 17,832,059 N87S possibly damaging Het
Stab2 A T 10: 86,873,864 V1639E probably damaging Het
Thpo T C 16: 20,725,775 N235S possibly damaging Het
Tmem63b T A 17: 45,660,796 H831L probably benign Het
Tomm20l T C 12: 71,111,467 V8A probably benign Het
Vill T C 9: 119,058,479 S104P probably damaging Het
Other mutations in Mob3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02210:Mob3c APN 4 115833755 missense probably damaging 1.00
R1718:Mob3c UTSW 4 115831644 missense probably benign 0.00
R1989:Mob3c UTSW 4 115831557 missense probably damaging 1.00
R4678:Mob3c UTSW 4 115833771 splice site probably null
R4883:Mob3c UTSW 4 115833731 missense probably benign 0.11
R5610:Mob3c UTSW 4 115833681 missense probably benign 0.17
R7009:Mob3c UTSW 4 115831582 missense probably benign
R7248:Mob3c UTSW 4 115831684 missense probably benign
R7410:Mob3c UTSW 4 115831587 missense probably damaging 1.00
R8039:Mob3c UTSW 4 115831687 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGTCATCTTCAAGTCCCTG -3'
(R):5'- AATGCCATATAGCGGGGTGC -3'

Sequencing Primer
(F):5'- AAGTCCCTGTGCCGAGAGATC -3'
(R):5'- TGCTGAGAGCTTGGCGG -3'
Posted On2020-07-28