Incidental Mutation 'R8281:Cyp3a13'
ID638194
Institutional Source Beutler Lab
Gene Symbol Cyp3a13
Ensembl Gene ENSMUSG00000029727
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 13
Synonymssteroid inducible, IIIAm2
Accession Numbers

Genbank: NM_007819

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8281 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location137892932-137921619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 137894297 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 495 (S495C)
Ref Sequence ENSEMBL: ENSMUSP00000031741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031741]
Predicted Effect probably benign
Transcript: ENSMUST00000031741
AA Change: S495C

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000031741
Gene: ENSMUSG00000029727
AA Change: S495C

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
Pfam:p450 38 493 1.3e-130 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes, which participate in drug metabolism and the synthesis of cholesterol, steroids and other lipids. This enzyme hydroxylates testosterone and dehydroepiandrosterone 3-sulphate, which is involved in the formation of estriol during pregnancy. This gene is part of a cluster of related genes on chromosome 7q21.1. Naturally-occurring readthrough transcription occurs between this gene and the downstream CYP3A51P pseudogene and is represented by GeneID:100861540. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show no apparent alterations in hematology, plasma clinical chemistry or pathology. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T A 5: 24,549,010 H417L probably benign Het
Adam7 G A 14: 68,507,885 T630I possibly damaging Het
Adgrf3 T C 5: 30,197,303 S576G possibly damaging Het
Asxl1 A G 2: 153,399,401 R625G probably damaging Het
Atp1a1 A G 3: 101,579,624 F916L probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
B230359F08Rik A G 14: 53,795,461 R3G possibly damaging Het
Chd9 A G 8: 91,036,597 D2350G probably damaging Het
Cic G A 7: 25,271,824 V327I probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Crym T A 7: 120,202,027 probably benign Het
D5Ertd579e A T 5: 36,613,320 F137I Het
Dip2a T C 10: 76,276,604 T1087A probably damaging Het
Drc7 G A 8: 95,062,177 E288K possibly damaging Het
Epb41l4a T C 18: 33,878,945 E174G probably damaging Het
Ern2 T C 7: 122,170,260 R848G probably damaging Het
F13b G T 1: 139,510,951 R364S probably benign Het
F2rl1 A G 13: 95,514,077 L99P probably damaging Het
Fam193a C A 5: 34,443,436 N171K unknown Het
Fst A G 13: 114,455,241 S201P probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm597 C T 1: 28,778,144 C269Y possibly damaging Het
Gm6460 T A 5: 11,597,679 M128K probably damaging Het
Gm8232 A G 14: 44,437,091 I182V Het
Gm8251 T G 1: 44,056,538 D1800A possibly damaging Het
Kalrn C T 16: 34,035,061 W1956* probably null Het
Klk1b16 A G 7: 44,141,547 M258V probably benign Het
Lta4h G T 10: 93,453,594 D29Y probably damaging Het
March7 C T 2: 60,234,529 S383L probably benign Het
Mob3c T C 4: 115,831,438 I56T probably benign Het
Msl2 T C 9: 101,101,695 S423P probably benign Het
Otop3 T C 11: 115,345,075 I511T possibly damaging Het
Pbld2 T G 10: 63,048,026 L90R probably damaging Het
Pcdh8 A G 14: 79,769,479 V548A probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch2 T A 4: 155,006,973 M228L probably benign Het
Prkdc T C 16: 15,705,253 C1180R probably damaging Het
Rasl2-9 A T 7: 5,125,352 L193* probably null Het
Rbp3 A G 14: 33,956,363 K756R probably benign Het
Rp1 T C 1: 4,347,916 E991G probably damaging Het
Slc12a7 G A 13: 73,790,677 R191H probably damaging Het
Spaca6 A G 17: 17,832,059 N87S possibly damaging Het
Stab2 A T 10: 86,873,864 V1639E probably damaging Het
Thpo T C 16: 20,725,775 N235S possibly damaging Het
Tmem63b T A 17: 45,660,796 H831L probably benign Het
Tomm20l T C 12: 71,111,467 V8A probably benign Het
Vill T C 9: 119,058,479 S104P probably damaging Het
Other mutations in Cyp3a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Cyp3a13 APN 5 137911933 missense probably benign 0.08
IGL01879:Cyp3a13 APN 5 137919003 missense probably benign
IGL01886:Cyp3a13 APN 5 137898820 missense probably damaging 1.00
IGL02048:Cyp3a13 APN 5 137918995 splice site probably benign
IGL02102:Cyp3a13 APN 5 137911603 missense probably benign 0.00
IGL02285:Cyp3a13 APN 5 137909967 missense probably benign 0.38
IGL03213:Cyp3a13 APN 5 137894267 utr 3 prime probably benign
IGL03238:Cyp3a13 APN 5 137898889 missense probably damaging 0.99
G4846:Cyp3a13 UTSW 5 137898823 missense possibly damaging 0.55
IGL02988:Cyp3a13 UTSW 5 137899010 nonsense probably null
PIT4486001:Cyp3a13 UTSW 5 137909966 missense probably benign 0.17
R0319:Cyp3a13 UTSW 5 137898862 missense probably damaging 1.00
R1024:Cyp3a13 UTSW 5 137894364 missense possibly damaging 0.56
R1189:Cyp3a13 UTSW 5 137911630 splice site probably null
R1464:Cyp3a13 UTSW 5 137905565 missense possibly damaging 0.83
R1464:Cyp3a13 UTSW 5 137905565 missense possibly damaging 0.83
R1501:Cyp3a13 UTSW 5 137911630 splice site probably null
R1838:Cyp3a13 UTSW 5 137911632 splice site probably null
R1956:Cyp3a13 UTSW 5 137909942 missense probably benign 0.02
R1981:Cyp3a13 UTSW 5 137911856 missense probably damaging 0.97
R2048:Cyp3a13 UTSW 5 137909975 missense probably damaging 0.98
R2140:Cyp3a13 UTSW 5 137921454 missense possibly damaging 0.93
R4844:Cyp3a13 UTSW 5 137917551 missense probably benign
R5001:Cyp3a13 UTSW 5 137898916 missense probably benign 0.00
R5062:Cyp3a13 UTSW 5 137898899 missense possibly damaging 0.52
R5420:Cyp3a13 UTSW 5 137898981 missense probably damaging 1.00
R5855:Cyp3a13 UTSW 5 137919056 missense probably damaging 0.98
R6089:Cyp3a13 UTSW 5 137909953 missense probably benign 0.07
R6927:Cyp3a13 UTSW 5 137895284 missense probably damaging 1.00
R6978:Cyp3a13 UTSW 5 137905539 missense probably benign 0.01
R7283:Cyp3a13 UTSW 5 137905556 missense probably benign 0.01
R7571:Cyp3a13 UTSW 5 137898863 missense possibly damaging 0.93
R7781:Cyp3a13 UTSW 5 137898874 missense possibly damaging 0.94
RF007:Cyp3a13 UTSW 5 137894263 makesense probably null
RF020:Cyp3a13 UTSW 5 137894263 makesense probably null
X0024:Cyp3a13 UTSW 5 137900391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAAGAACCAGGGAGTTG -3'
(R):5'- GGCAGTAAAAGTAGGTTTTGTGCAC -3'

Sequencing Primer
(F):5'- GTTACACCCTTATGTTCCACAGAAG -3'
(R):5'- GTGCACTTGTAAAGCACTTTTAGC -3'
Posted On2020-07-28